Transcript asmbl_189416

Sequence
Transcript Sequence for observation asmbl_189416 of TGE0006294:
GCGCCTTCCGGTGCGCCTTCCGGTGCGCCTTCCGCTCCGCCCCTTCAGGCAGGAAGTGTCGGCGCCGCCACTGTCCGGCCACAGCCTAACGCTCTTCGCTGTCGTTTGTGGTCTCGCGCAGGGCGGCCCCGGTTCTGGTGTTTGGCGTCGGAATTAAACAACCACCATGTCGAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGCTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTTGATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATGAAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTTCTCAGACACTTCCCCCACCCTCATAGAACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACTTGTATAATCAGACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACAAATGTGAAAGCCCAGAAAAATATATTCGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGTTATTTTGAAATAAAGATTATGCTGACTCAAATG