Transcript asmbl_189415

Sequence
Transcript Sequence for observation asmbl_189415 of TGE0000954:
AAAAAAGAAGGAAACTCAGTAACAGGACCCAGAGGACCATTATATATTGCTCTATATTCTAGGTCGCCCACTTTACACTTCCTTCTCATGCACTTGGTCAATACCACGCCCGCTGACCACACTGGCGACTTCCCTCTCTGTCGCCCCTCCGTGAAGTCAGACCCACTCTGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGAT