Transcript asmbl_4617

Sequence
Transcript Sequence for observation asmbl_4617 of TGE0005748:
CGCCGGTCCTAGCCCGGGAAAACGCCCTCTGCGGTGAAGGAGAGGTGCGCGGCTGGCGGTTTCCAGACTCGGGTCCTGGGAAGGCGGCGAAGAGAGGGGCCAGAGGGCTGGAAGACTGAGTCCCAGCGGAGGGCGAGCCGGATCACGCCGCCATGCCTCGCTCTGGGTCGCGAGCAGTCTTCCTCCTCTTGTCGCCGCTGCTGCTGCTCCGCGCTGTTTTGACTGTGCCCCTGGAGCGAGGGGCGCCCAAGGAGGAGAGCCCCGCGACCGAGAGCCCCGACACGGGCCTGTACTACCACCGGTACCTCCAGGAGGTCATCAATGTCCTGGAGACTGATGGGCACTTCCGCGAGAAGCTGCAGGCCGCCAATGCCGAGGACATCAAGAGCGGGAAGCTGAGCCGGGAGCTGGACTTTGTCAGCCACCACGTCCGCACCAAGTTGGACGAGCTCAAGAGGCAGGAGGTGTCGCGGCTTCGGATGCTGCTCAAGGCCAAGATGGACGCAGAGCAGGAGCCCAATGTACAGTTGGACCACTTGAGCCTCCTGAAGCAGTTCGAACACCTGGACCCTCAGAACCAGCACACATTTGAGGCCCGAGACCTGGAGCTGCTGATCCAGACGGCCACCCGCGACCTTGCCCAGTACGACGCGGCCCATCACGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCGTTATCTGGAGTCACTGGGAGAGGAGCAGCGGAAGGAGGCAGAGAGGAAACTGGAAGAACAACAGCGACGGCACCGAGAGCACCCCAAAGTCAATGTGCCTGGCAGCCAAGCTCAGTTGAAGGAGGTGTGGGAGGAGCTGGATGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGATATCAACAGCGATGGTGTCCTAGATGAGCAGGAGCTGGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTATATGACCCGAAGAATGAGGAAGACGACATGCGGGAGATGGAGGAGGAGCGACTGCGCATGCGGGAGCACGTGATGAAGAATGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTATGGGGACACCGGGGAGGGCTGGGAGACGGTGGAGATGCATCCTGCCTACACGGAGGAAGAGCTGAGGCGTTTCGAGGAGGAGCTGGCCGCCCGGGAGGCAGAGCTGAATGCCAAGGCCCAGCGCCTCAGCCAGGAGACAGAGGCTTTGGGGCGCTCCCAGGACCGCCTGGAGGCCCAGAAGAGAGAGCTGCAGCAGGCGGTTATGCAGATGGAGCAGAGGAAGCAGCAGCAGCAGCAGCAGCAG