Transcript asmbl_182400

Sequence
Transcript Sequence for observation asmbl_182400 of TGE0000937:
CTTGAACCCAGGAGGCAGAGGTTGCAGTGAGCCGAGATTGTGCCATTGTACTCAAGCCTGGGCGACACTGAGACTACGTCTCAAAAAAATAATCAATCAATAAATAAAAGAGGCGTCCACGTTAACGAGTCCACAGTCCTAACAAGTGCTGCAGGCTGGACGCGGGGCAGCGTCCCACCCAGTGTCTGGTGCAGGGCATTTAGGGGCTTGGCCTCCAGGAGAGGCGAGCCCGGGGCTGGGTGCGAGCACTGCTGCTGGGCCAGGCCACTCACGTTATGCGGCCGTTCCTGATACTTCAACACGGCCCTTGTGGGCGAATGTGTGGAATCTCGGAACAAGCGGAGTGGGGAACAGGGCTCTGCGGTGAAGCCCAGGCTGAGGCAGCCCCTCATCTGCTCACGGTGCCAGGAGCTCCCTGCCTCCTGGTCCTGAGGAGCCGCGGGATTCCTCAGGGACACTAGGGCCTCTGCAGCGGCGCCTGCGCCAGGCAGCCACGCGCGCTGCGCACGAATTCTGTCTCAGCCTGGAGAAAAACACCTCCGCTGCGCCCTCGCCCAGCACCAGCTTTCCGCGGGGCGTGCAAGGGGCTCCTCCTAGCCCCACAGCCCTGTCTTTCCACGGGGGACACCAAGGCCCTGGAACGGCCCGCGCGCCAGCGCTCTCGCCCGTGTTTAACGAGAACTTAATCCCCGTGCCCGTTACCTCCCCGAAGTCCCGGGACTAGGTGACTAGGCCCCGAAGCAAGAGTCGCAGTCGGACCGACTGGGCCGGGGAGGGCAGCGCACTGCACCTGCGCGGGCTTCCACAGCCCACGCGGCCGCCGCAGGCCTCGAGTGGGCGCGGGTTGGGCAGCGGCGAGAGGCGGGACCGGACCTCGCCTCCCGGGTGCGGGCGCCCTGGGCTCGCGTAGGGAAGTGCCCTGGCTTACAGAGGTGACCACTGACGGGGCTTGGGGTGGAAGGTGACGACGCCAGAACCCACGCGGAACGCGCCCACGAGGCCCAGCCGCAAGATGGCGACGGCGTGCCCCCGGCCACCCGCGCGCCGCGCATGCGCCCTGGCCTTCCCCGCCCGAGTGAGCGGAAGTCTCGTGACCCCGGAAGTGACAGGCAGGGCGGGCGGGGCGGCCGACGACGTTCGTCATTTAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGGCTAAGCTTGAGCATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACTCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGCGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTGGAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGAGCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTGTCCCCCCCAGCCCCTCCCCTCCCCATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCCGCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCGACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAGCCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGTGGGGGAGAGAGGCCGCAGCCAGGCCTCTGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCTGGCTTCAGGAGGGAGCGGAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGGAGCTGGGGTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTGTCGCTGTCGGTCCCGTCTAACCATGATGCCTTAACATGTGGAGTGTACCGTGGGGCCTCACTAGCCTCTAACTCCCTGTGTCTGCATGAGCATGTGGCCTCCCCGTCCCTTCCCCGGTGGCGAACCCAGTGACCCAGGGACACGTGGGGTGTGCTGCTGCTGCTCCCCAGCCCACCAGTGCCTGGCCAGCCTGCCCCCTTCCCTGGACAGGGCTGTGGAGATGGCTCCGGCGGCTTGGGGAAAGCCAAATTGCCAAAACTCAAGTCACCTCAGTACCATCCAGGAGGCTGGGTATTGTCCTGCCTCTGCCTTTTCTGTCTCAGCGGGCAGTGCCCAGAGCCCACACCCCCCCAAGAGCCCTCGATGGACAGCCTCACTCACCCCACCTGGGCCCAGCCAGGAGCCCCGCCTGGCCATCAGTATTTATTGCCTCCGTCCGTGCCGTCCCTGGGCCACTGGCCTGGCGCCTGTTCCCCCAGGCTCTCAGTGCCACCACCCCCGGCAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACATTGCTGAGAGCCGTCTCCTGTGCCTCCCCCGCCCCATCCCCGGTCTTCGTGTTGTGTCTGCCAGGCTCAGGCAGAGGCGCCTGTCCCTGCTTCTTTTCTGACCGGGAAATAAATGCCCCTGAAGGAGCTGGGGGTGTCTGCTGCTTGGCTTCTCCAGGGTGTGGCAGGGGAGGGCCTGGCTCCTCTACTGCCTCACGGGCTTTAGGAGACAAAGGGGAAGATGGGGACCCTGGTGGGGTGGTGGGAGGGGAAGGGCAGGGCCCCCTTGAAGTGCTGTGGCTGCTGGGCCCCTTGCAACTATCTGGGGAGAAAGGAATGTGACTCCCAGCTACAGTAGCCCTAGGCAGCAACAGTCTAGAACAGTGCAGAAGGCCTTGGCTGGGGTTGCCCCTCCTTGCTAAGGGAATGGGAAGACGGGCCTGGCTTGTGTAGCTCATGCTGCCAGAGGGAGAGCTGCTTGATTCCCTGGCCGGGCTTGGAGGTGTCGAGTTGGCCCAGCTGTGCGCGGGCCCTCCAATGACTGGATCCCAAGGAAACCCAGGGAGGAACAGGCCCAAGCCAGGGTCGGCCTTGTGGCCCCTGGCGCACGTGGATGCAGCTGTGGCTGAGGCAGGAAGTAGGTGCCCAGGCAACGGGGGCCACGGAGGCGCCTAGAGCACCAGCCCTTCACAGCCACAGCCGCAGCCAAGTGCCCTCCAGGATCGGGCAGTGCCAGGAGCCCAACAGCGAAAAGGCTTGGTGTGATGGGATCGGCAGGAGACAGGGCATCCTCACTGCGGTGTGGTGTGAAGGGGCTACTGGGGGAACCACGCAGGGCCTCCTGGGGCAGGTGCGCTCAGCCAGGGGCCCCAACTGCTGCAGCATCCAGGAACCCCAGCTCGTCCGTGTCTGCAGTCTCCAAGAGCCCCCGGGAACTTCAAACCCATGCCCCTCTACCCTGCAGGGGGAAGAGGCAGATGAGTAACCAGGCACCCCTTAGAAGTGTCCATTCAGAAATTCTTTTTCTGGCCTGATGCGAGTTTCAAAATCTGCCTTCTGTGGTATAAGGTGTTGAGGAAAATACTTCACACACACACGCAGCTGGGCTGGGCAGCTGCTACCCCGGGGCCCTCCTACTGGTCATTCTGACACAGGCCATACTGCTCTGGGGTTTATCAGCAGGGTGGGCCCCGCAAGGGGCTTATCTCCAGCTGGGGTGGGCAGGGAGATGCCCTCATGCTTCAGGTCACTAACTACACACCTGTGCCAGGGCAGTGCGTGCGGGCACCACTGCCACCTTGCCCCATCCTTGCTAGGCCTTTGTGGGGGCCGCAGAGGCTGAGCCTAGAGCTGACCGTGTCAGACACCCCAACAGAATGGTGCCTTCCTGCAGAAGCTGGTCCAGACCCAGATCTGGAAGCAGCTATAGAGAAAGCCTGGGTCAGCCCCCAGCCCTTGATTCCGCAGGGAGCAAAGACCCTACCGAGCCTTTCCCAGAACTGCTACTAGCCCCAAGCGAGGTGGTCTCGTGTTGCGTTGCTGCTTCTGCCTGTGCTG