Transcript asmbl_182399

Sequence
Transcript Sequence for observation asmbl_182399 of TGE0000937:
GGCGCCGGCGGGGGCGGGGGGCGCTGAGGTGGGGGCTTCCGCCTTTGTTCGCGCCCCGCCCTGAGCCCGCGGCAGGGTCTCGGCGGGCGGGGGCGCGGTGACAGCGGGCCAGGGCGGTGCGGGCTAGGGCGGGGCCGGGGCGGGACCGGGCGGCGGCGGCCCCGGCCCCACGTGCGGGTCCCGGGCCGGAGGGGCGGCGGGGACCAGGGGAGTGCCGGCCCCTCCCGAGCGGTCCGGAGCTTCTTTCATGGCCGCCGAGGCGCGTGGGGCCCGGGCCAGACCTGAGGGCCCCTCCTTGGGGACGCGGGGGGCGCCGGGCCGGCAGCCGCGGTCCATCGCGTTCGGGGGCGACGCGGGGATTGGGGCGCGGCCTCCCCCAGCGCCCGGGCCACGCCCGGCACGGATTGCGGGCCCTGCGGAAGTGCGGGCCGCGCCCTAGGATCCCGGCGCCTACGGCTATCCTCGCGCGGCGCGGAGGCCCCAGCCCCTGGAGGAAGCAGGGCGGCCTGGACCCCGGCCTGGGTGTCCCGGGTGTGCTGCTCCCTGACCCACCTCCCACGCTGCCGGGAAGGATCTGAGCCTGACAGATCCCCTGCCGGGTCAGTGCTGCCCCGGGCACTCCGGGCCCACCATCTACAAGAGGGCCCGAGAGTACTGAGTGGCTGTGGTAGCTCCCAAGTTGTAGGTCACAGACCCTCACAATTGTGGAGAAACCGCAGATACTTAGGATCCCCGTGTCCAGGTGGCCCCGTGCGGTATTCTAGCTGCCCCTAACATCCGAGCTCCAGGGGCATCCTGTTTGAAAGATGACGCTGAGCCGACCACACACGTTTACATGTGACTACCACGGCCAGAGGAGCAACCCTACTGAGGGATACCGAGCCCCGTTACCCCGTAGGGCGAGGGCCTGGGCAGCTCAAGAGCGGCAAGACCCTAAGAGAGGGTTTAGTGTGGGCCCCGCCGGTTGATTCTGGGGCCTGCTAGCCCCGCCCCACACATACAGGGGGCTGCTGCCTCCTCCATCGTGGAGGGGGAGGTGTGTCCTCTCTCCCCATGATCGGCTGCAGTTCCCATTTTGTCTTAGATGTTATACCTGGGGTGGGGGCACCTCACACTGCCCCAGAGGATGCCCCTGAGCAGGAATCGCGGGGGTGGAGAGGAGCGAAGGTGGCCCCCTTGGAGCCCTTTTGGAGCTCCGGCTGCAGCCCACACTCCTGCTCAGAAGTGCGCCTCCGTTGGGGATCCAGGTCCAAGGCCTGTCACCGTCCCGCCCACAGGTGTCCCGACCCAGGCTAAGCTTGAGCATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACTCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGCGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTGGAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGAGCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTGTCCCCCCCAGCCCCTCCCCTCCCCATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCCGCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCGACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAGCCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGTGGGGGAGAGAGGCCGCAGCCAGGCCTCTGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCTGGCTTCAGGAGGGAGCGGAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGGAGCTGGGGTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTGTCGCTGTCGGTCCCGTCTAACCATGATGCCTTAACATGTGGAGTGTACCGTGGGGCCTCACTAGCCTCTAACTCCCTGTGTCTGCATGAGCATGTGGCCTCCCCGTCCCTTCCCCGGTGGCGAACCCAGTGACCCAGGGACACGTGGGGTGTGCTGCTGCTGCTCCCCAGCCCACCAGTGCCTGGCCAGCCTGCCCCCTTCCCTGGACAGGGCTGTGGAGATGGCTCCGGCGGCTTGGGGAAAGCCAAATTGCCAAAACTCAAGTCACCTCAGTACCATCCAGGAGGCTGGGTATTGTCCTGCCTCTGCCTTTTCTGTCTCAGCGGGCAGTGCCCAGAGCCCACACCCCCCCAAGAGCCCTCGATGGACAGCCTCACTCACCCCACCTGGGCCCAGCCAGGAGCCCCGCCTGGCCATCAGTATTTATTGCCTCCGTCCGTGCCGTCCCTGGGCCACTGGCCTGGCGCCTGTTCCCCCAGGCTCTCAGTGCCACCACCCCCGGCAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACATTGCTGAGAGCCGTCTCCTGTGCCTCCCCCGCCCCATCCCCGGTCTTCGTGTTGTGTCTGCCAGGCTCAGGCAGAGGCGCCTGTCCCTGCTTCTTTTCTGACCGGGAAATAAATGCCCCTGAAGGAGCTGGGGGTGTCTGCTGCTTGGCTTCTCCAGGGTGTGGCAGGGGAGGGCCTGGCTCCTCTACTGCCTCACGGGCTTTAGGAGACAAAGGGGAAGATGGGGACCCTGGTGGGGTGGTGGGAGGGGAAGGGCAGGGCCCCCTTGAAGTGCTGTGGCTGCTGGGCCCCTTGCAACTATCTGGGGAGAAAGGAATGTGACTCCCAGCTACAGTAGCCCTAGGCAGCAACAGTCTAGAACAGTGCAGAAGGCCTTGGCTGGGGTTGCCCCTCCTTGCTAAGGGAATGGGAAGACGGGCCTGGCTTGTGTAGCTCATGCTGCCAGAGGGAGAGCTGCTTGATTCCCTGGCCGGGCTTGGAGGTGTCGAGTTGGCCCAGCTGTGCGCGGGCCCTCCAATGACTGGATCCCAAGGAAACCCAGGGAGGAACAGGCCCAAGCCAGGGTCGGCCTTGTGGCCCCTGGCGCACGTGGATGCAGCTGTGGCTGAGGCAGGAAGTAGGTGCCCAGGCAACGGGGGCCACGGAGGCGCCTAGAGCACCAGCCCTTCACAGCCACAGCCGCAGCCAAGTGCCCTCCAGGATCGGGCAGTGCCAGGAGCCCAACAGCGAAAAGGCTTGGTGTGATGGGATCGGCAGGAGACAGGGCATCCTCACTGCGGTGTGGTGTGAAGGGGCTACTGGGGGAACCACGCAGGGCCTCCTGGGGCAGGTGCGCTCAGCCAGGGGCCCCAACTGCTGCAGCATCCAGGAACCCCAGCTCGTCCGTGTCTGCAGTCTCCAAGAGCCCCCGGGAACTTCAAACCCATGCCCCTCTACCCTGCAGGGGGAAGAGGCAGATGAGTAACCAGGCACCCCTTAGAAGTGTCCATTCAGAAATTCTTTTTCTGGCCTGATGCGAGTTTCAAAATCTGCCTTCTGTGGTATAAGGTGTTGAGGAAAATACTTCACACACACACGCAGCTGGGCTGGGCAGCTGCTACCCCGGGGCCCTCCTACTGGTCATTCTGACACAGGCCATACTGCTCTGGGGTTTATCAGCAGGGTGGGCCCCGCAAGGGGCTTATCTCCAGCTGGGGTGGGCAGGGAGATGCCCTCATGCTTCAGGTCACTAACTACACACCTGTGCCAGGGCAGTGCGTGCGGGCACCACTGCCACCTTGCCCCATCCTTGCTAGGCCTTTGTGGGGGCCGCAGAGGCTGAGCCTAGAGCTGACCGTGTCAGACACCCCAACAGAATGGTGCCTTCCTGCAGAAGCTGGTCCAGACCCAGATCTGGAAGCAGCTATAGAGAAAGCCTGGGTCAGCCCCCAGCCCTTGATTCCGCAGGGAGCAAAGACCCTACCGAGCCTTTCCCAGAACTGCTACTAGCCCCAAGCGAGGTGGTCTCGTGTTGCGTTGCTGCTTCTGCCTGTGCTG