Transcript asmbl_182398

Sequence
Transcript Sequence for observation asmbl_182398 of TGE0000937:
GGCGCCGGCGGGGGCGGGGGGCGCTGAGGTGGGGGCTTCCGCCTTTGTTCGCGCCCCGCCCTGAGCCCGCGGCAGGGTCTCGGCGGGCGGGGGCGCGGTGACAGCGGGCCAGGGCGGTGCGGGCTAGGGCGGGGCCGGGGCGGGACCGGGCGGCGGCGGCCCCGGCCCCACGTGCGGGTCCCGGGCCGGAGGGGCGGCGGGGACCAGGGGAGTGCCGGCCCCTCCCGAGCGGTCCGGAGCTTCTTTCATGGCCGCCGAGGCGCGTGGGGCCCGGGCCAGACCTGAGGGCCCCTCCTTGGGGACGCGGGGGGCGCCGGGCCGGCAGCCGCGGTCCATCGCGTTCGGGGGCGACGCGGGGATTGGGGCGCGGCCTCCCCCAGCGCCCGGGCCACGCCCGGCACGGATTGCGGGCCCTGCGGAAGTGCGGGCCGCGCCCTAGGATCCCGGCGCCTACGGCTATCCTCGCGCGGCGCGGAGGCCCCAGCCCCTGGAGGAAGCAGGGCGGCCTGGACCCCGGCCTGGGTGTCCCGGGTGTGCTGCTCCCTGACCCACCTCCCACGCTGCCGGGAAGGATCTGAGCCTGACAGATCCCCTGCCGGGTGTCCCGACCCAGGCTAAGCTTGAGCATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACTCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGCGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTGGAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGAGCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTGTCCCCCCCAGCCCCTCCCCTCCCCATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCCGCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCGACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAGCCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGTGGGGGAGAGAGGCCGCAGCCAGGCCTCTGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCTGGCTTCAGGAGGGAGCGGAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGGAGCTGGGGTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTGTCGCTGTCGGTCCCGTCTAACCATGATGCCTTAACATGTGGAGTGTACCGTGGGGCCTCACTAGCCTCTAACTCCCTGTGTCTGCATGAGCATGTGGCCTCCCCGTCCCTTCCCCGGTGGCGAACCCAGTGACCCAGGGACACGTGGGGTGTGCTGCTGCTGCTCCCCAGCCCACCAGTGCCTGGCCAGCCTGCCCCCTTCCCTGGACAGGGCTGTGGAGATGGCTCCGGCGGCTTGGGGAAAGCCAAATTGCCAAAACTCAAGTCACCTCAGTACCATCCAGGAGGCTGGGTATTGTCCTGCCTCTGCCTTTTCTGTCTCAGCGGGCAGTGCCCAGAGCCCACACCCCCCCAAGAGCCCTCGATGGACAGCCTCACTCACCCCACCTGGGCCCAGCCAGGAGCCCCGCCTGGCCATCAGTATTTATTGCCTCCGTCCGTGCCGTCCCTGGGCCACTGGCCTGGCGCCTGTTCCCCCAGGCTCTCAGTGCCACCACCCCCGGCAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACATTGCTGAGAGCCGTCTCCTGTGCCTCCCCCGCCCCATCCCCGGTCTTCGTGTTGTGTCTGCCAGGCTCAGGCAGAGGCGCCTGTCCCTGCTTCTTTTCTGACCGGGAAATAAATGCCCCTGAAGGAGCTGGGGGTGTCTGCTGCTTGGCTTCTCCAGGGTGTGGCAGGGGAGGGCCTGGCTCCTCTACTGCCTCACGGGCTTTAGGAGACAAAGGGGAAGATGGGGACCCTGGTGGGGTGGTGGGAGGGGAAGGGCAGGGCCCCCTTGAAGTGCTGTGGCTGCTGGGCCCCTTGCAACTATCTGGGGAGAAAGGAATGTGACTCCCAGCTACAGTAGCCCTAGGCAGCAACAGTCTAGAACAGTGCAGAAGGCCTTGGCTGGGGTTGCCCCTCCTTGCTAAGGGAATGGGAAGACGGGCCTGGCTTGTGTAGCTCATGCTGCCAGAGGGAGAGCTGCTTGATTCCCTGGCCGGGCTTGGAGGTGTCGAGTTGGCCCAGCTGTGCGCGGGCCCTCCAATGACTGGATCCCAAGGAAACCCAGGGAGGAACAGGCCCAAGCCAGGGTCGGCCTTGTGGCCCCTGGCGCACGTGGATGCAGCTGTGGCTGAGGCAGGAAGTAGGTGCCCAGGCAACGGGGGCCACGGAGGCGCCTAGAGCACCAGCCCTTCACAGCCACAGCCGCAGCCAAGTGCCCTCCAGGATCGGGCAGTGCCAGGAGCCCAACAGCGAAAAGGCTTGGTGTGATGGGATCGGCAGGAGACAGGGCATCCTCACTGCGGTGTGGTGTGAAGGGGCTACTGGGGGAACCACGCAGGGCCTCCTGGGGCAGGTGCGCTCAGCCAGGGGCCCCAACTGCTGCAGCATCCAGGAACCCCAGCTCGTCCGTGTCTGCAGTCTCCAAGAGCCCCCGGGAACTTCAAACCCATGCCCCTCTACCCTGCAGGGGGAAGAGGCAGATGAGTAACCAGGCACCCCTTAGAAGTGTCCATTCAGAAATTCTTTTTCTGGCCTGATGCGAGTTTCAAAATCTGCCTTCTGTGGTATAAGGTGTTGAGGAAAATACTTCACACACACACGCAGCTGGGCTGGGCAGCTGCTACCCCGGGGCCCTCCTACTGGTCATTCTGACACAGGCCATACTGCTCTGGGGTTTATCAGCAGGGTGGGCCCCGCAAGGGGCTTATCTCCAGCTGGGGTGGGCAGGGAGATGCCCTCATGCTTCAGGTCACTAACTACACACCTGTGCCAGGGCAGTGCGTGCGGGCACCACTGCCACCTTGCCCCATCCTTGCTAGGCCTTTGTGGGGGCCGCAGAGGCTGAGCCTAGAGCTGACCGTGTCAGACACCCCAACAGAATGGTGCCTTCCTGCAGAAGCTGGTCCAGACCCAGATCTGGAAGCAGCTATAGAGAAAGCCTGGGTCAGCCCCCAGCCCTTGATTCCGCAGGGAGCAAAGACCCTACCGAGCCTTTCCCAGAACTGCTACTAGCCCCAAGCGAGGTGGTCTCGTGTTGCGTTGCTGCTTCTGCCTGTGCTG