Transcript asmbl_182247

Sequence
Transcript Sequence for observation asmbl_182247 of TGE0000930:
GGCACAGCGAGGTCGGCAGCGGCAGCGAGGTCGGCAGCGGCGCGCGCTGTGCTCTTCCGCGGACTCTGAATCATGGCGACCACGGCCACGATGGCGACCTCGGGCTCGGCGCGAAAGCGGCTGCTCAAAGAGGAAGACATGACTAAAGTGGAATTCGAGACCAGCGAGGAGGTGGATGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTGCGGGGCATCTACGCTTACGGTTTTGAAAAACCATCAGCAATCCAGCAACGAGCAATCAAGCAGATCATCAAAGGGAGAGATGTCATCGCACAGTCTCAGTCCGGCACAGGAAAAACAGCCACCTTCAGTATCTCAGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAAACTCAAGCTTTGATCTTGGCTCCCACAAGAGAGTTGGCTGTGCAGATCCAGAAGGGGCTGCTTGCTCTCGGTGACTACATGAATGTCCAGTGCCATGCCTGCATTGGAGGCACCAATGTTGGCGAGGACATCAGGAAGCTGGATTACGGACAGCATGTTGTCGCGGGCACTCCAGGGCGTGTTTTTGATATGATTCGTCGCAGAAGCCTAAGGACACGTGCTATCAAAATGTTGGTTTTGGATGAAGCTGATGAAATGTTGAATAAAGGTTTCAAAGAGCAGATTTACGATGTATACAGGTACCTGCCTCCAGCCACACAGGTGGTTCTCATCAGTGCCACGCTGCCACACGAGATTCTGGAGATGACCAACAAGTTCATGACCGACCCAATCCGCATCTTGGTGAAACGTGATGAATTGACTCTGGAAGGCATCAAGCAATTTTTCGTGGCAGTGGAGAGGGAAGAGTGGAAATTTGACACTCTGTGTGACCTCTACGACACACTGACCATCACTCAGGCGGTCATCTTCTGCAACACCAAAAGAAAGGTGGACTGGCTGACGGAGAAAATGAGGGAAGCCAACTTCACTGTATCCTCAATGCATGGAGACATGCCCCAGAAAGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCGGGCGCCAGCCGAGTGCTTATTTCTACAGATGTCTGGGCCAGGGGGTTGGATGTCCCTCAGGTGTCCCTCATCATTAACTATGATCTCCCTAATAACAGAGAATTGTACATACACAGAATTGGGAGATCAGGTCGATACGGCCGGAAGGGTGTGGCCATTAACTTTGTAAAGAATGACGACATCCGCATCCTCAGAGATATCGAGCAGTACTATTCCACTCAGATTGATGAGATGCCGATGAACGTTGCTGATCTTATCTGAAGCAGCAGATCAGTGGGATGAGGGAGACTGTTCACCTGCTGTGTACTCCTGTTTGGAAGTATTTAGATCCAGATTCTACTTAATGGGGTTTATATGGACTTTCTTCTCATAAATGGCCTGCCGTCTCCCTTCCTTTGAAGAGGATATGGGGATTCTGCTCTCTTTTCTTATTTACATGTAAATAATACATTGTTCTAAGTCTTTTTCATTAAAAATTTAAAACTTTTCCCATAAACTCTATACTTCTAAGGTGCCACCACCTTCTCTAGTAACTTACTGTGTAGTCTTGGGTCATTTCACTCACTTTTCTTTTTTTCTTTTCTTTTTCTTTTT