Transcript asmbl_182176

Sequence
Transcript Sequence for observation asmbl_182176 of TGE0067850:
CCAGTCCCTGGGCGCACGTCCCGGATTCCTCCCACGAGGGGGCGGGCTGCGGCCAAATCTCCCGCCAGGTCAGCGGCCGGGCGCTGATTGGCCCCATGGCGGCGGGGCCGGCTCGTGATTGGCCAGCACGCCGTGGTTTAAAGCGGTCGGCGCGGGAACCAGGGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGCTGCATTAACCTGCCCACTGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATTCTCGGGCCGATGTTCTCAGGAAAAAGCACAGAGTTGATGAGACGCGTCCGTCGCTTCCAGATTGCTCAGTACAAGTGCCTGGTGATCAAGTATGCCAAAGACACTCGCTACAGCAGCAGCTTCTGCACACATGACCGGAACACCATGGAGGCACTGCCCGCCTGCCTGCTCCGAGACGTGGCCCAGGAGGCCCTGGGCGTGGCTGTCATAGGCATCGACGAGGGGCAGTTTTTCCCTGACATCGTGGAGTTCTGCGAGGCCATGGCCAACGCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTGGGGCCATCCTGAACCTGGTGCCGCTGGCCGAGAGCGTGGTGAAGCTGACGGCGGTGTGCATGGAGTGCTTCCGGGAAGCCGCCTATACCAAGAGGCTCGGCACAGAGAAGGAGGTCGAGGTGATTGGGGGAGCAGACAAGTACCACTCCGTGTGTCGGCTCTGCTACTTCAAGAAGGCCTCAGGCCAGCCTGCCGGGCCGGACAACAAAGAGAACTGCCCAGTGCCAGGAAAGCCAGGGGAAGCCGTGGCTGCCAGGAAGCTCTTTGCCCCACAGCAGATTCTGCAATGCAGCCCTGCCAACTGAGGGACCTGCGAGGGCCGCCCGCTCCCTTCCTGCCACTGCCGCCTACTGGACGCTGCCCTGCATGCTGCCCAGCCACTCCAGGAGGAAGTCGGGAGGCGTGGAGGGTGACCACACCTTGGCCTTCTGGGAACTCTCCTTTGTGTGGCTGCCCCACCTGCCGCATGCTCCCTCCTCTCCTACCCACTGGTCTGCTTAAAGCTTCCCTCTCAGCTGCTGGGACGATCGCCCAGGCTGGAGCTGGCCCCGCTTGGTGGCCTGGGATCTGGCACACTCCCTCTCCTTGGGGTGAGGGACAGAGCCCCACGCTGTTGACATCAGCCTGCTTCTTCCCCTCTGCGGCTTTCACTGCTGAGTTTCTGTTCTCCCTGGGAAGCCTGTGCCAGCACCTTTGAGCCTTGGCCCACACTGAGGCTTAGGCCTCTCTGCCTGGGATGGGCTCCCACCCTCCCCTGAGGATGGCCTGGATTCACGCCCTCTTGTTTCCTTTTGGGCTCAAAGCCCTTCCTACCTCTGGTGATGGTTTCCACAGGAACAACAGCATCTTTCACCAAGATGGGTGGCACCAACCTTGCTGGGACTTGGATCCCAGGGGCTTATCTCTTCAAGTGTGGAGAGGGCAGGGTCCACGCCTCTGCTGTAGCTTATGAAATTAACTAATTGAAAATTCACTGGTTGGTGGACGCACATTTCTCTTTCACCTGGGTTTCCCTGGGTCTCATGGACAGCTCCAACTTGATTTGGGTGGGGATTTTCTTCCAGATCTTTTTTTCTTTTGTTTTGAGACAGGGTCTCTGTCGCCCAGG