Transcript asmbl_182023

Sequence
Transcript Sequence for observation asmbl_182023 of TGE0000925:
ACAGGCTTTTAGAGAGTCGCCAGGCTCCCTGCCCTCATCCGAGATGGCGGCCTGAGGGCGCTCTAGCCGACGCTCTTCGGATGCCCGGAGGGGGCGGTGGCCTTGCCTCTGGCTCTGAGGCGGCGGCGCCGGGCGCTGCGAAGGCTCGGCCGCTGTAGTCAGTGGTGTGGGGTGCGCAAGGGCACGGACCTCGGAGCTCTCCCCGCTTGCGCCGAGTTTCTCAGCGCCTTCCCCACCCAAACCGGGGTCTCGCAGTCGGAAGCACTCAGAGTGCAGCCCCGCGCGGGGCCGGTCGTAACCGCGCCGCGGGCCGGACGATGCCCAAGAAGCTGCTGCTGTTGCCCCCGCCCTCCGCGTCCTCGGCTTTCCGCGTCCCGCGCGCCCGCCCCGTTCCCCCGCCGGCCATGAACGCCGCTCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACGGAGCTGGCCAAGCGCATCACAGAGCGCCTTGGTGCTGAATTGGGGAAGTCTGTTGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTCATCATGGCTTACGCACTGAAGACTGCCTGTGCCAGGAACATTATTGGGGTCATCCCCTACTTCCCCTACAGCAAGCAGAGCAAGATGAGGAAGAGGGGTTCCATTGTGTGCAAGCTGCTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGATCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCTGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATTGTAGCTAAGTCTCCTGATGCTGCAAAGAGGGCCCAGTCCTATGCGGAGAGACTGCGTCTGGGTTTGGCCGTCATTCACGGGGAAGCTCAGTGCACGGAACTGGACATGGACGATGGTCGTCACTCCCCGCCTATGGTCAAAAATGCTACTGTGCACCCAGGCCTGGAGTTGCCATTGATGATGGCCAAAGAGAAGCCACCGATAACTGTAGTTGGAGATGTTGGAGGCCGCATCGCAATCATCGTGGATGACATTATTGACGATGTGGAGAGTTTTGTTGCTGCCGCGGAGATCCTGAAAGAGAGAGGCGCCTATAAGATCTATGTTATGGCCACCCACGGCATCCTGTCTGCAGAGGCCCCTCGCCTGATTGAGGAGTCCTCCGTAGACGAGGTGGTGGTGACGAATACTGTCCCTCATGAGGTTCAGAAGCTGCAATGTCCCAAGATAAAGACTGTGGATATCAGTTTGATTCTTTCTGAAGCCATTCGGAGAATCCACAATGGAGAGTCCATGGCCTACCTTTTCCGAAACATCACTGTGGATGACTAGCTTTCACGAGGGTCTCGACCCTGGACCTCCTGAGGGAAACATGGAAAAAGCAGTGCCATGAGTGATACAGTGTTTCCTTGCAAGGGAGGACTCGAAACAGCCTGGAGTTAGATATCTTCTTTTGCCCGGATTGATGGGGAGGAGGGATTAAAAGAGTCAGGAAGAAGACAGAGCTAATGGATAAATATCATAACATGGCCTTACATGTCTGCTGTCATCAGCCCTGTTCCTTAAAAGTTCTAGCTGCTTTCTTAAAAATAATCTGAAAATCTTATTGATACTAAAGAGGAGTTAAAGGCACATAAAGTCTTAACTCTATAATGTTCATTTAGTTGTTTCAGCTCCAGGGAAATGGAGGTATTGATGTTGAACCTGGTTAGGGAAGCTGAGCGCCTGTGGCCCTATTACTATCCAGTTGGCCTCTCCCAAATCAACTTCAAGTCTTTTATAGAGAATCGTATTTTTCTTTCAGAAATTGTTATGCCTACAGCCATTGAAAAATGAAGCATTCATGTTGTTACATCTTCCAAGGATGTCAGATTAGAAAATAGCATCCCACCTCTGGGTATCTGAGTGGCTCTGAAGTTGCAAATAAAATAATTTGTTGTCTTGCTAGTCTTTTCATTAGACAGCAGAAGACCATGGATACAGAACAGCAGTCAGGTCTGTGGCTGGACACAAACACTTTCCCAGGTTCCACCCTCTTCCTAAGTGTTGAAGCTAAATCCTTGTTGAATACTGTATTTTAAATCTTT