Transcript asmbl_181848

Sequence
Transcript Sequence for observation asmbl_181848 of TGE0000916:
CGGGGAGGTCTGGCGCATGCGCCCTGACACCTAGCTGGTTCCCTACCCGCAGGGGCCCGGCTGAGGAGGAGCGCTTGCGCTCTGGGCCTTTTCCGCCGGGGGAAGTCTCGCGGGGGCGGGGCGGGGCCTCGTGGAGAAGTTCTCGCGGGACACCGACGGGGAGCGGAAGCCAGGAGGTATTGCTGCTTCGGCGACCGGGCGGCGGCAGCGGCGGCGGCGGCTGTGGCAGAGTCTGTGCCTGTGGCGGTGACGGCGGCGGGAGCAAGCGCTGCCCTCGCAGAGCAGCCTTGGGGTCGCCGGCCGCTCGCAGCGTTGTGGAGGGGCGGGCCGGACGCTGAGCGGAGCAGCTGCGCCACGGGTGGCATTGTGTGTCCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTGCTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCAGAATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCAAAAGGGGGGACATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAGAGCTTAATGGAAAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAGGCAGAAGAAATGCTTAGCAAACAGCGGCACGATGGGGCCTTTCTTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCAAGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTGTCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCCGACATACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGGGAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACGGGCAGACCGGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAAGAGTCAAGAAGCAATTATTTAAAGAAAGTGAAAAATGTAAAACACATACAAAAGAATTAAACCCACAAGCTGCCTCTGACAGCAGCCTGTGAGGGAGTGCAGAACACCTGGCCGGGTCACCCTGTGACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTTGGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCAGGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCCAGCCCAGACCCCCAGTGTATTTTGTCCAAGTTCACAGTAGAGTAGGGTAGAAGGAAAGCATGTCTCTGCTTCCATGGCTTCCTGAGAAAGCCCACCTGGGCTGGGCGCGGTGGCTCACGCCT