Transcript asmbl_180284

Sequence
Transcript Sequence for observation asmbl_180284 of TGE0067780:
TTCTCCTCCACGTGGGGACGCAGGATGGCGGCAGCAGTGCCGGACGAGGCGGTGGCGCGCGATGTGCAGCGGTTGCTAGTGCAGTTCCAGGATGAGGGCGGGCAGCTGCTGGGTTCCCCGTTCGACGTGCCCGTGGACATCACCCCGGACAGGCTGCAGCTCGTGTGCAACGCGCTACTGGCCCAGGAGGATCCCCTGCCACTGGCTTTCTTTGTCCACGATGCTGAGATCGTCTCCTCACTGGGGAAGACGTTGGAGTCCCAGGCAGTGGAGACAGAGAAGGTCCTAGACATCATCTACCAGCCACAGGCTATCTTCAGAGTCCGGGCTGTGACTCGCTGCACCAGCTCCTTGGAGGGTCACAGTGAGGCAGTCATTTCTGTGGCCTTCAGCCCTACGGGAAAGTACCTGGCCAGTGGCTCTGGAGACACCACCGTGCGCTTCTGGGATCTCAGCACAGAGACACCACATTTCACATGCAAGGGACACAGACACTGGGTCCTTAGTATATCCTGGTCTCCAGATGGCAGGAAGCTGGCCTCAGGCTGCAAGAATGGCCAGATTCTCCTCTGGGACCCAAGCACAGGGAAGCAGGTGGGCAGGACCCTCGCTGGCCACAGCAAGTGGATCACAGGCCTGAGCTGGGAGCCCCTCCATGCGAACCCTGAGTGCCGCTATGTGGCCAGCAGCTCCAAGGATGGCAGTGTGCGGATCTGGGACACAACTGCAGGCCGCTGTGAGCGCATCCTCACCGGGCACACCCAGTCGGTCACCTGTCTCCGGTGGGGAGGGGACGGGCTTCTCTACTCTGCCTCCCAGGACCGCACCATCAAAGTCTGGAGAGCTCATGACGGTGTGCTGTGCCGGACTCTGCAAGGCCACGGCCACTGGGTGAACACCATGGCCCTCAGCACTGACTATGCCCTGCGCACTGGGGCCTTTGAACCTGCTGAGGCCTCAGTTAATCCCCAAGACCTCCAAGGATCCTTGCAGGAGTTGAAGGAGAGGGCTCTGAGCCGATACAACCTCGTGCGGGGCCAGGGTCCAGAGAGGCTGGTGTCTGGCTCCGACGACTTCACCTTATTCCTGTGGTCCCCAGCAGAGGACAAAAAGCCTCTCACTCGGATGACAGGACACCAAGCTCTCATCAACCAGGTGCTCTTCTCTCCTGACTCCCGCATCGTGGCTAGTGCCTCCTTTGACAAGTCCATCAAGCTGTGGGATGGCAGGACGGGCAAGTACCTGGCTTCCCTACGCGGCCACGTGGCTGCCGTGTACCAGATTGCGTGGTCAGCTGACAGTCGGCTCCTGGTCAGCGGCAGCAGTGACAGCACACTGAAGGTGTGGGATGTGAAGGCCCAGAAGCTGGCCATGGACCTGCCCGGCCACGCGGATGAGGTATATGCTGTTGACTGGAGTCCAGATGGCCAGAGAGTGGCAAGTGGTGGGAAGGACAAATGCCTCCGGATATGGAGGAGATGAGACGGCCCGAAGTTCTCTCTGACCCCCACCTCGACTCGGCCTCTGCCAGCTGCCTTCCCTGCCAGAGAACAAAGGCTGAGATGGCAGTGCACACACCCTCCCCACCAGTGGGGACCTGAGAATGCGTGTGGCCTGCTGTCCTCGATAGACCGGAATGGGGTTTTCCCACAGATCCCCGCCTGTGGCACACCCCAGAGCCAGAAATCGAAGGTCACAGGAAGTTGTCACTGAACTTGGCCCGTGTCTGCTACTCTGTACCTTGCTGGTACAGACAGGGGTGGTGGGCAGCCAGGCTCTATGAGTGGGCCCCTAGTGTCAGCTCTGTACAGGGTCAGATCCCAGGTTCTATGACCAAATAAGTAACTTAAGTTTTGTGTGTTGGGTTCTAATTCCTTGTCCTAGAATCCCCATGACTCAATCAAGGACTGTGCTAAATGAGATTGTCCAGCCCCCGCCCTTGCACTGGACTACGCCAAAACCACACTGACCAGGCACTTGCCTTCCCTCTCTTCCCCCGTGTTGGTAAGAGAGAGGCCAGTTGTGATAGTGGCCAAGGAGAATCTAGGGCTGTATTGTTGTCCACTGCAGTAGGCACCGGCCACATGTGACTGCTGGCATGAAATAGAAGTGCAGTTCCTCCATCGCACTGGGTAAGGCCTCCAGTATTGGACAGCACACAGAAAGGTTTTCATCATCAAGAGAGTTCTGCTGGTCAGCCCTGCTCCAGGGGATGCCTCTGCCTTCGCATAGCACACTGCTTGAGGCCCTGCCAGGCACCAAGCACTGCCCTGGGCCCATGGGATAGAGCGGGGAAGGTGATGGCTCTTCCAGAGGATTCCCTCAGATGGGGAGGCAGCAGTATGAGCTCTGAGCAGAAGTGGGTATTGTTGATACAGAGGAAGTTCTTTGCCACGAGAACTTTCAAGCAGTGAAAGGAATTCCCATCAGGACTCAGACCCCAGGCCGAGATCTTGCCCTGAATGTACCCTGCCTCTGCTTTCTCCTGCATCCCATGCTAAGCAGGGTCATGGTCTGAACTACTCAGATTGGATTTCCAAACCATCCTTGTATAAACTGCTCAGAACTAGCATCTTGCTCCTTCTTACCCTCCTCCACCCTTGTCTGTGCTTTTGGGTTTTGCGCGTCACCTAGCTGTGGTGCTTGGCCTCCACCTTGCACATATCTGCAGTGAGGCTACATAAGAAGCGAACAAAACTATCAGCCACTGAGCTCCTTGGTGCCAGCTGTTTGTCTGCTGTGCTCTCAGACTGCACCAGGCCTGGAAGGTTCTCAAGCTCCAAAACTTTTGATGAGGAAACAACATAAGAAATGATTAGCCCATGCCCTCACATCTAGTAAGAGAAAGCTGGGATTAAACCAGGCCCTGCCCCAAAGCTTATTGTGCACTTTGTACCACATCCCTCCGTCCAGAGCTCAAGCTAGTTTGACAGTTCATGGGCCACCACGTCTGTCCATGACAGCTATTTCTGTATTTTTCTGGTGTAAGAGCCTTTTAGTCTTAGAGCACCAGTCTCCCTGTTCCCCTACCCCGCCCCACTGGGGAAGGGGTGATGGCAGCATCCTATTGCCTAGCTGCCTGTTTTCTATCTCCCCACCCATGTAGACTCTGTCCTGGTGGAAGCTAGGAGGTGGGTGCCAGCCAGCCCATCTGAGGCTGTCTGCAGCATAAAGCAGACTTTAGGGTGCTGGATGACCTGCAGTTCTTTAATGAGGGACCTAGACCCAGCCCAGATTTGGAGGAGGAGGGAGTCTAGCAGCTGTGGGCAGTGGCTGAGCCTGGCATGGCCTGGCCTGAGATGCCTCCAGGTGAATGGGGCCCCTATGTAGCCTTGGCCCCAGCCCAGGGGTGGGGTGCCCATACCACTCTGCCAGACCCCGGGCCCGCAGGGTGCTGGTGGTATGGTAGGTCTCATGGCTCTGGTTTCTGAGGGCCTGGGGTTGAAGCTGAAAGTAGGTGAGGGGTGTCCTGGGGCCCTCCCCCTTAACAGGGAAATAGGTATTCCAGATCCTCCAGCCTCCGCATCTCCTCCGGCCCGATGGACACGATCTTTTGCCGGGGTTCCTTGCGCCGCACGGTGATCTGGATGGGGTAGTTCTCAGGAAAGCTGCTGAAGTCAGTGGCCAGGGTTGCAAACTGAAGTGAAACAAGAAAACCCTTCAGAGTTCCTTCCCAGATCTGAACCTGGCTCTCTCTCTGTCTCTATCACCCCTTTTTTTTCTGTCTGCTGACTCAGACCTTAAACAGCCTTATCCAACCTAGCCATTGACGCAGGAAACAGGTGCAAAGATGCATGACTCAAGCCTGTACCTCCTCATTATGGGATATTTCCAACCAAAGGGCTGTCTGTACTCAGGCCTCTATACCCCCATACCCCTACCCCATACCCAGGCTGTTCCCTTCTTCGTCCCCCTTTAGCCTCTTGTCTTCCCTATTTCTTTCAATGCCCTTGACTTCCCAGCCTACTCACAATCATGGGCACTGAATTGCAGAGTCTAAAAACCAATGGCTTTGGAAGGGGAACATTATAGTGATGTTGAAAAATACATTCGTTTGCATTCCTAGTGGGCCCCAGAGTGGCTTAATCCTTAAACCTCCCAGAAGCATGCATTCTGGAATTGATGCTTCTTGACCCAGGCAGAAGGAAAGCTAGCCAGATGAGTCATGTGGGCATAGGGGTGTTCCCAACCTCCAAAGCCCTGGTTCCCTGGCTTTGGACTTCTCTCCACCCCCAAGGCCCCTCTTTTCCCAGGGCTCACTTTGTAGGGCTTGCACCACTTCCCCACCCCAGCTGTGTTGGCTGCACGGACACTGAGGCAGTAACACGTGTTAGGCTTTAGCTCCATCAGCTTGACAGTAGTGCCCAAAATCTTGTTGAAGATCCATGGACGATTCTTTGCCTCGGGCAACTCATTCTCCTGTGTCTTGGCCACCTCCTGTAACAGGAGCTGGTAGAAACTGACCGGCTGCTTGCCCAAGGCGTAGGTCCAGGAAATCTAGGGGAAGAGAGAGCCCCGAGGCTTCCTCAGATATGTCCTGTCCTTCCTGTCCCTTCACCCTCCCAACTGGGGTCAGGACGTCCCATGCCCATCCCCTGCTCCTGCTGGGGCCCAGGCAGGTCAGATGGAAGGTGCAAGGTACTGCAGCACTGAGTGTGGAACCCCTGCCCCGAAGCATGTACTACTCTCCTGGGCAGCCCCACCCACTTTAGGGTACACCCTCATTCCATATTTCTTATACGCCAGGGGTCCTCAACCCTTGGGCCACCAACTGATAGCAGTCCATGGCCTGTTAGGAACTGGATAGCACAGCAGGAGGAGATTGGTGGGCGAGCAAGCGAAGCTTCATCTGTATTTACAGCTGCTCCCCACGGCTCAGGGTACCACCTGAGCTCTGCCTCCTGTCAGAT