Transcript asmbl_180252

Sequence
Transcript Sequence for observation asmbl_180252 of TGE0000865:
GTGGCTGTAGAAGCCGAAGGGCCTTCCCCTAAGTAGGAGGTGGCGGAAGCGGAAAAGGCGGGACCTAGGGAGCACGTTACGTCCGGACGCGTCGGTGGTAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTTCGCTGTTGAGAAGCTACCCGCGGGGTTGTAGACCTCGGACCTCATGGCAGAGATAATTCAGGAACGCATAGAAGATCGGCTCCCGGAATTGGAACAGCTGGAGCGCATTGGACTGTTCAGTCATGCGGAGATTAAGGCTATCATTAAGAAGGCTTCCGATCTAGAGTACAAAATCCAGAGAAGAACCCTTTTCAAGGAAGACTTTATCAATTATGTTCAATATGAAATTAATCTTTTGGAGCTGATCCAGAGAAGAAGAACACGCATTGGATATTCATTTAAGAAGGATGAGATTGAGAATTCTATTGTACACCGGGTACAAGGTGTTTTCCAGCGTGCCTCAGCAAAATGGAAAGACGATGTTCAACTTTGGCTCTCCTATGTGGCTTTTTGTAAGAAGTGGGCTACTAAAACTCGACTTAGCAAGGTATTCTCTGCCATGTTGGCGATTCATTCCAACAAACCAGCTTTGTGGATTATGGCAGCCAAATGGGAAATGGAAGATCGATTGTCTTCAGAAAGCGCAAGGCAACTATTTCTTCGCGCACTGCGCTTTCATCCAGAGTGCCCAAAACTTTATAAAGAATACTTTAGGATGGAGCTGATGCATGCTGAAAAACTGAGGAAGGAGAAGGAAGAATTTGAAAAAGCCAGTATGGATGTGGAGAATCCTGATTATTCTGAAGAAATCCTTAAGGGCGAGTTGGCATGGATCATCTACAAAAATTCTGTAAGCATAATTAAAGGTGCAGAATTTCACGTGTCACTGCTTTCGATTGCACAGCTATTTGACTTTGCCAAAGATCTACAAAAAGAGATTTATGATGACCTTCAGGCTCTACACACAGATGATCCTCTCACTTGGGATTATGTGGCAAGGCGAGAATTAGAGATTGAGTCACAGACAGAAGAGCAGCCTACAACGAAACAAGCCAAAGCAGTGGAGGTCGGCCGGAAGGAGGAGAGGTGCTGTGCTGTGTATGAAGAGGCAGTGAAGACTCTGCCAACAGAGGCCATGTGGAAGTGTTACATCACCTTTTGCTTGGAAAGATTTACTAAGAAGTCAAATAGTGGGTTCCTTAGAGGGAAGAGGTTGGAAAGAACCATGACTGTATTCAGGAAGGCACATGAACTGAAGCTTCTGTCAGAATGCCAATACAAGCAGTTGAGTGTTTCGTTGCTGTGTTATAACTTCCTGAGGGAAGCTCTGGAAGTGGCAGTAGCTGGAACTGAATTGTTTAGAGACTCTGGGACAATGTGGCAGCTGAAGCTGCAGGTGCTGATCGAGTCAAAGAGCCCTGACATAGCCATGCTTTTTGAAGAAGCCTTTGTGCACCTGAAACCCCAGGTTTGTCTGCCATTGTGGATTTCCTGGGCAGAGTGGAGTGAAGGTGCCAAAAGCCAAGAAGACACTGAGGCAGTCTTTAAGAAAGCTCTCTTAGCTGTCATAGGTGCCGACTCAGTAACCCTGAAGAATAAGTACCTGGATTGGGCTTATCGAAGTGGTGGCTACAAAAAGGCCAGAGCTGTGTTTAAAAGTTTACAGGAGAGCCGACCATTTTCAGTTGACTTTTTCAGGAAAATGATTCAGTTTGAAAAGGAGCAAGAATCCTGCAATATGGCGAACATAAGAGAATATTATGAGAGAGCTTTGAGAGAGTTTGGATCCGCAGATTCTGATCTTTGGATGGATTATATGAAAGAAGAATTGAACCACCCCCTTGGTAGACCTGAGAACTGTGGACAGATCTACTGGCGAGCGATGAAAATGTTGCAGGGAGAGTCAGCAGAGGCATTTGTAGCTAAACATGCTATGCATCAGACTGGCCATTTATGAAGATGAAGAATACAGTCAGCTTTGTGAAATAGTATTGCAAGCAAGCCCCGTGGGCAAATTTGTATTGAGTCCATCTGTAATTTGCTCAGTGATGGCAGACAAGATGGCTGTCTGGTTTTGAGACACACTTTAATTTTATGTTAACTTGTTAAATCTTTTTAAAAATTAAAAAATTTTTATGATTGAGACTGGGTCTTGCTCTGTTGCCCTGGCTGG