Transcript asmbl_180186

Sequence
Transcript Sequence for observation asmbl_180186 of TGE0067775:
AGGAGGGGGTGGCGAGGGCGGGCAGCGAGGCCTGGAGCCGCCAGGAGAGGGGCGGGGGGCGGCCCTTCTCCAGGAATTTCCGGGGATCGTGTTACAGCGTTGGCGGAGCCCGAGCGGAGTGGGACTCGAGGCCCTGTAGCCGGACTGGGCCCCTCGCCCCCTCCTCCAGCGGCCTGCGGGCCTTGGCAGCGCCGCCCCTGCCCACACTGACCCCGTGTGGCGGGGCCGCTCCGCGCCCCCGGGCCGCTCTGTAATGGTAGGGCAGCCTCAGCCCCGAGATGACGTCGGGTCTCCGCGGCCCCGGGTTATTGTAGGAACCATCCGGCCCCGCGTAATCGTAGGAACTATCCGGCCCCGCGTAATCGTAGGGTCTGCGCGGGCCCGGCCCCCACCAGACGGGACTCCCCGCCCCCAATTGGCGGCCGAAGAGTCTCCTCGCCCCAGAGTCATCTTCGGGACGCCCAGGGCCCGGGTGATTTTGGGCTCGCCGCGGCCCCGGGTGATTGTTTCATCTCCGTGGCCCGCGGTGGTCGTAGCGTCTCCGAGACCGCGGACTCCCGTAGGGTCCCCGTGGCCCCGAGTTGTAGTCGGGACACCCCGGCCGCGGGTGATCGTCGGGTCTCCACGCGCCCGGGTCGCTGACGCGGATCCGGCCTCGGCGCCTTCTCAGGGCGCCCTGCAAGGCCGCAGGCAGGATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGGCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCACCGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATTAATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAACGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTGTAGGTTCCAAGAAGGATCTGAGTGTGAGTGTGCCAGTGGGGGGACTTCCCAGCTTGGTGAGGGAATGCCCCCCTCTGACTCTGGCCTTCCCTCAGACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGCATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCACATGTTGCCCATGAGGGCTGAGGAGACTGTTCAGAGACTGCCCAGCCCTAGGGCACTGTGCCACCCTCATTCCTCCAGAGCTTGACCCCTGGACATTTGCACTGACTTTATCCAGACCAAAGAGCTGCCTCTTGGTGGCAGTATTCCCACAGAGGGGTAGCTGGGATCATGCTAGTCACTTCCTGCCCCCAGGCACCGTGCCAAAGACTGGATGCCCCCTACTCCTCAGGGGACTGTCCAGGGCGCCCAGTGGTAGTGAGGGAGAGTGTCTCTGTTCTTTTGCTCAGCCTGCTGGGCCCTTTGTGTTTGAGGATGCTTAATGATTCCAGCCTCTCACTGTGCCTTATGCATTAAAATTTCTTTGTTACGAGCA