Transcript asmbl_45700

Sequence
Transcript Sequence for observation asmbl_45700 of TGE0001625:
TTTTTGCTCTTTCTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATGATGGTTTTAGCTTCTCAAACTTTCCACCGAGAAGCTGTGGAAAGCCATCATTTCCTACCAGATGATTTCCGGTAGTTCAAAAT