Transcript asmbl_45699

Sequence
Transcript Sequence for observation asmbl_45699 of TGE0001625:
TTTTTGCTCTTTCTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTTGTGTATCATATTTTCTGTTAGCATGTAGTATTTCCAGCTACTTTCTATTGTTATAAAATATTGTAATACTAAGTCTGGTTTTTACACTTTTGTATTATTTTTGTTTTGTCTTACAGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATGATGGTTTTAGCTTCTCAAACTTTCCACCGAGAAGCTGTGGAAAGCCATCATTTCCTACCAGATGATTTCCGGTAGTTCAAAAT