Transcript asmbl_179873

Sequence
Transcript Sequence for observation asmbl_179873 of TGE0006885:
CAGGGACCCAGGCGACCGGCCGGCCGGCGTCCCCGCGCCTCCTGGCGGCCAGAAGCAGGGCCTGCGCTTCCCCGGCTAAGGGGTGCCGGCCCCCGCCCCGGCACCTGGGAGTGAAGGTACCAGCGGGTCTCCTGGGCGGTCTCCTGGGGCCGCTCGTTCCTTCATCACCCCCAGGGGCAGTTGGACCCTGAGCAGCCTTAGCCAATAGCCCCGGGACTACCCTTCCCAGAGGATTCAGCGGCAGCACCCGGGTCTCGGAAGGGAGACACTAGGACCTGGAGGAGGGGAGTTTTGCAATCCCTCGCAGTTCCCCTCCTAGCCACTAGGTGACACTAGCCATAAATTTATTTCCCAGTTTACTCCCCTCGCTCAAACTCCGCGCCCCTCTCGCTCCGAGAGACATAGGTCTCGCGAGATCTTTGGTAAACTTACAGAACCGGAAGCAGCGTGTAGTTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGACCGAAGCAAGAATCGCAAAAGGCATTTCAATGCACCTTCCCACATTCGAAGGAAGATTATGTCTTCCCCTCTTTCCAAAGAGCTGAGACAGAAGTACAACGTGCGATCCATGCCCATCCGAAAGGATGATGAAGTTCAGGTTGTACGTGGACACTATAAAGGTCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATATGTTATCTACATTGAACGGGTGCAGCGGGAAAAGGCTAATGGCACAACTGTCCACGTAGGCATTCACCCCAGCAAGGTGGTTATCACTAGGCTAAAACTGGACAAAGACCGCAAAAAGATCCTCGAACGGAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATACAAGGAAGAAACCATTGAGAAGATGCAGGAATAAAGTAATCTTATATACAAGCTTTGATTAAAACTTG