Transcript asmbl_178854

Sequence
Transcript Sequence for observation asmbl_178854 of TGE0000815:
CGCCTCCTCGCGGCTCTAGGGCCGGCGCGGTGACGTGCGCGTGCGCGCACTGGAGGGAAAAGGCGGAAGCGGAAGTCGGGGGGCGCGCCAGCTCGTAGCAGGGGAGCGCCCGCGGCGTCGGGTTTGGGCTGGAGGTCGCCATGGGGCGAGGCAGCGGCACCTTCGAGCGTCTCCTAGACAAGGCGACCAGCCAGCTCCTGTTGGAGACAGATTGGGAGTCCATTTTGCAGATCTGCGACCTGATCCGCCAAGGGGACACACAAGCAAAATATGCTGTGAATTCCATCAAGAAGAAAGTCAACGACAAGAACCCACACGTCGCCTTGTATGCCCTGGAGGTCATGGAATCTGTGGTAAAGAACTGTGGCCAGACAGTTCATGATGAGGTGGCCAACAAGCAGACCATGGAGGAGCTGAAGGACCTGCTGAAGAGACAAGTGGAGGTAAACGTCCGTAACAAGATCCTGTACCTGATCCAGGCCTGGGCGCATGCCTTCCGGAACGAGCCCAAGTACAAGGTGGTCCAGGACACCTACCAGATCATGAAGGTGGAGGGGCACGTCTTTCCAGAATTCAAAGAGAGCGATGCCATGTTTGCTGCCGAGAGAGCCCCAGACTGGGTGGACGCTGAGGAATGCCACCGCTGCAGGGTGCAGTTCGGGGTGATGACCCGTAAGCACCACTGCCGGGCGTGTGGGCAGATATTCTGTGGAAAGTGTTCTTCCAAGTACTCCACCATCCCCAAGTTTGGCATCGAGAAGGAGGTGCGCGTGTGTGAGCCCTGCTACGAGCAGCTGAACAGGAAAGCGGAGGGAAAGGCCACTTCCACCACTGAGCTGCCCCCCGAGTACCTGACCAGCCCCCTGTCTCAGCAGTCCCAGCTGCCCCCCAAGAGGGACGAGACGGCCCTGCAGGAGGAGGAGGAGCTGCAGCTGGCCCTGGCGCTGTCACAGTCAGAGGCGGAGGAGAAGGAGAGGCTGAGACAGAAGTCCACGTACACTTCGTACCCCAAGGCGGAGCCCATGCCCTCGGCCTCCTCAGCGCCCCCCGCCAGCAGCCTGTACTCTTCACCTGTGAACTCGTCGGCGCCTCTGGCTGAGGACATCGACCCTGAGCTCGCACGGTATCTCAACCGGAACTACTGGGAGAAGAAGCAGGAGGAGGCTCGCAAGAGCCCCACGCCATCTGCGCCCGTGCCCCTGACGGAGCCGGCTGCACAGCCTGGGGAAGGGCACGCAGCCCCCACCAACGTGGTGGAGAACCCCCTCCCGGAGACAGACTCTCAGCCCATTCCTCCCTCTGGTGGCCCCTTTAGTGAGCCACAGTTCCACAATGGCGAGTCTGAGGAGAGCCACGAGCAGTTCCTGAAGGCGCTGCAGAACGCCGTCACCACCTTCGTGAACCGCATGAAGAGTAACCACATGCGGGGCCGCAGCATCACCAATGACTCGGCCGTGCTCTCACTCTTCCAGTCCATCAACGGCATGCACCCGCAGCTGCTGGAGCTGCTCAACCAGCTGGACGAGCGCAGGCTGTACTATGAGGGGCTGCAGGACAAGCTGGCACAGATCCGCGATGCCCGGGGGGCGCTGAGTGCCCTGCGCGAAGAGCACCGGGAGAAGCTTCGCCGGGCAGCCGAGGAGGCAGAGCGCCAGCGCCAGATCCAGCTGGCCCAGAAGCTGGAGATAATGCGGCAGAAGAAGCAGGAGTACCTGGAGGTGCAGAGGCAGCTGGCCATCCAGCGCCTGCAGGAGCAGGAGAAGGAGCGGCAGATGCGGCTGGAGCAGCAGAAGCAGACGGTCCAGATGCGCGCGCAGATGCCCGCCTTCCCCCTGCCCTACGCCCAGCTCCAGGCCATGCCCGCAGCCGGAGGTGTGCTCTACCAGCCCTCGGGACCAGCCAGCTTCCCCAGCACCTTCAGCCCTGCCGGCTCGGTGGAGGGCTCCCCAATGCACGGCGTGTACATGAGCCAGCCGGCCCCTGCCGCTGGCCCCTACCCCAGCATGCCCAGCACTGCGGCTGATCCCAGCATGGTGAGTGCCTACATGTACCCAGCAGGGGCCACTGGGGCGCAGGCGGCCCCCCAGGCCCAGGCCGGACCCACCGCCAGCCCCGCTTACTCATCCTACCAGCCTACTCCCACAGCGGGCTACCAGAACGTGGCCTCCCAGGCCCCACAGAGCCTCCCGGCCATCTCTCAGCCTCCGCAGTCCAGCACCATGGGCTACATGGGGAGCCAGTCAGTCTCCATGGGCTACCAGCCTTACAACATGCAGAATCTCATGACCACCCTCCCAAGCCAGGATGCGTCTCTGCCACCCCAGCAGCCCTACATCGCGGGGCAGCAGCCCATGTACCAGCAGATGGCACCCTCTGGCGGTCCCCCCCAGCAGCAGCCCCCCGTGGCCCAGCAACCGCAGGCACAGGGGCCGCCGGCACAGGGCAGCGAGGCCCAGCTCATTTCATTCGACTGACCCAGGCCATGCTCACGTCCGGAGTAACACTACATACAGTTCACCTGAAACGCCTCGTCTCTAACTGCCGTCGTCCTGCCTCCCTGTCCTCTACTGCCGGTAGTGTCCCTTCTCTGCGAGTGAGGGGGGGCCTTCACCCCAAGCCCACCTCCCTTGTCCTCAGCCTACTGCAGTCCCTGAGTTAGTCTCTGCTTTCTTTCCCCAGGGCTGGGCCATGGGGAGGGAAGGACTTTCTCCCAGGGGAAGCCCCCAGCCCTGTGGGTCATGGTCTGTGAGAGGTGGCAGGAATGGGGACCCTCACCCCCCAAGCAGCCTGTGCCCTCTGGCCGCACTGTGAGCTGGCTGTGGTGTCTGGGTGTGGCCTGGGGCTCCCTCTGCAGGGGCCTCTCTCGGCAGCCACAGCCAAGGGTGGAGGCTTCAGGTCTCCAGCTTCTCTGCTTCTCAGCTGCCATCTCCAGTGCCCCAGAATGGTACAGCGATAATAAAATGTATTTCAGAAAGCATCAGCGTTTTTTCTTTAATTAATTTTTTTGAGATGGAGTCTCACT