Transcript asmbl_178213

Sequence
Transcript Sequence for observation asmbl_178213 of TGE0000808:
GCGGAGGGAGGGCGGCAGCCAGGATGGTCCATTCCATTCTTGGAGCTGCACTGTTGACTTCGACCACAAGGGGGCAGGGCTGCTGAAATTGGAAGTGCGAACGCCTACATGAGTCTTGATCCTCGGCAGGCACCGTACCCAGTTTCCTCCGTTGGGAGGGTTTAACTGCCCGGAAACGGAAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTCCTGCTCACAGCCCGACGAAAGGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGACAACGTGAAGTTTAAAGTTCGATGCAGCAGATACCTTTACACCCTGGTCATCACTGACAAAGAGAAGGCAGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAACTGAAATGAACCAGACACACTGATTGGAACTGTATTATATTAAAATACT