Transcript asmbl_178212

Sequence
Transcript Sequence for observation asmbl_178212 of TGE0000808:
GCGGAGGGAGGGCGGCAGCCAGGATGGTCCATTCCATTCTTGGAGCTGCACTGTTGACTTCGACCACAAGGGGGCAGGGCTGCTGAAATTGGAAGTGCGAACGCCTACATGAGTCTTGATCCTCGGCAGGCACCGTACCCAGTTTCCTCCGTTGGGAGGGTTTAACTGCCCGGAAACGGAAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTCCTGCTCACAGCCCGACGAAAGGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGACAACGTGAAGTTTAAAGTTCGATGCAGCAGATACCTTTACACCCTGGTCATCACTGACAAAGAGAAGGCAGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAACTGAAATGAACCAGACACACTGATTGGAACTGTATTATATTAAAATACT