Transcript asmbl_177454

Sequence
Transcript Sequence for observation asmbl_177454 of TGE0067643:
AGGAACCCCCCATGTAGTGGGGCGCGGAGCCCTGCTCTCGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGCCGCAGATGATGGAAGGGAACGGGAACGGCCATGAGCACTGCAGCGATTGCGAGAATGAGGAGGACAACAGCTACAACCGGGGTGGTTTGAGTCCAGCCAATGACACTGGAGCCAAAAAGAAGAAAAAGAAACAAAAAAAGAAGAAAGAAAAAGGCAGTGAGACAGATTCAGCCCAGGATCAGCCTGTGAAGATGAACTCTTTGCCAGCAGAGAGGATCCAGGAAATACAGAAGGCCATTGAGCTGTTCTCAGTGGGTCAGGGACCTGCCAAAACCATGGAGGAGGCTAGCAAGCGAAGCTACCAGTTCTGGGATACGCAGCCCGTCCCCAAGCTGGGCGAAGTGGTGAACACCCATGGCCCCGTGGAGCCTGACAAGGACAATATCCGCCAGGAGCCCTACACCCTGCCCCAGGGCTTCACCTGGGATGCTTTGGACCTGGGCGATCGTGGTGTGCTAAAAGAACTGTACACCCTCCTGAATGAGAACTATGTGGAAGATGATGACAACATGTTCCGATTTGATTATTCCCCGGAGTTTCTTTTGTGGGCTCTCCGGCCACCCGGCTGGCTCCCCCAGTGGCACTGTGGGGTTCGAGTGGTCTCAAGTCGGAAATTGGTTGGGTTCATTAGCGCCATCCCAGCAAACATCCATATCTATGACACAGAGAAGAAGATGGTAGAGATCAACTTCCTGTGTGTCCACAAGAAGCTGCGTTCCAAGAGGGTTGCTCCAGTTCTGATCCGAGAGATCACCAGGCGGGTTCACCTGGAGGGCATCTTCCAAGCAGTTTACACTGCCGGGGTGGTACTACCAAAGCCCGTTGGCACCTGCAGGTATTGGCATCGGTCCCTAAACCCACGGAAGCTGATTGAAGTGAAGTTCTCCCACCTGAGCAGAAATATGACCATGCAGCGCACCATGAAGCTCTACCGACTGCCAGAGACTCCCAAGACAGCTGGGCTGCGACCAATGGAAACAAAGGACATTCCAGTAGTGCACCAGCTCCTCACCAGGTACTTGAAGCAATTTCACCTTACGCCCGTCATGAGCCAGGAGGAGGTGGAGCACTGGTTCTACCCCCAGGAGAATATCATCGACACTTTCGTGGTGGAGAACGCAAACGGAGAGGTGACAGATTTCCTGAGCTTTTATACGCTGCCCTCCACCATCATGAACCATCCAACCCACAAGAGTCTCAAAGCTGCTTATTCTTTCTACAACGTTCACACCCAGACCCCTCTTCTAGACCTCATGAGCGACGCCCTTGTCCTCGCCAAAATGAAAGGGTTTGATGTGTTCAATGCACTGGATCTCATGGAGAACAAAACCTTCCTGGAGAAGCTCAAGTTTGGCATAGGGGACGGCAACCTGCAGTATTACCTTTACAATTGGAAATGCCCCAGCATGGGGGCAGAGAAGGTTGGACTGGTGCTACAATAACCAGTCACCAGTGCGATTCTGGATAAAGCCACTGAAAATTCGAACCAGGAAATGGAACCCCACCACTGTTGGTCCAATTTTCACACACGTGAGAATCCCTGGCAAAGGGAGCAGAACTGAACCGGCTTTACCAAACCGCCAGCGAACTTGACAATTGTATTGCGATGGCGTGGGCTGCGTGACGTCACCTCCGGTCGTGTCTCTGGTCTCCGTGTTTTCCAGTTAATTACATCCTCATGCAGCCGTGATCAAGGGAATGTAACTGCTGAAAACTAGCTCGTGATTGGCATATAATGGAGTTAACGGGTGAATAATAAAAGTATATATATATATTATATATATATAAATATTTTAAATATCTTTCATGTTCCAAATGTACAAGGATGTTTGGTCTTTAATGAAAAGCTGAATCCAGATCATTCCTCAGAATGAGGACCCGAGGACAGTGGCAGACAGACGCGTTGGCACAGTTCATGGTTTCCTCCAGAGGAGACATTGGCTTATCATGGGGAAAAAGAGGATCTGGAGAACCTCATCCAGCTCCCCTTCTGAATCAGCTGGGATGACTGGCTTTGAGAAGGAAGGGAAGATGGAACAGGCTCAGATCTCATGGGATAGCACGTGGAGCTCTTGGCTGGGGCTGACCCTGGGCAGGGACTTTCCTGCAGGGCCAGACCTGCCTGCATTCTGAGACAAAGCAATGGACGGTCCGCAGAAGCAGACCTCATTGATTGAGTCCTTTCTTCCATCCCCTTGGCCTGCTCCCTGTAGGAAGTCATCCTGCCAACTGATTTAAAAGGGCTCTTTAGCCAGTTGTTGCCAACCTTATAGGGATGAGTCCCCTGTGAGATTTTGCTTTTCCACTGCCTGGGATGATGCAGTTTGAAGAGGCCCTTGGACCTCCTTGTAACATCAGGGACCTTTGGAGACCATTATCAGTGTAAGCCCTGCTTAGCTCATCTTAGAGCAAAGAGCCAGCACCCTGATGTCCCTGGGGTGGCTAGGCAGGAGTGGCGTGGGGCCAATACCCAGACCCCTTCAGCCACCAGCCCCTGGCCTGTGCCTTCCAACCCATTAGCCATTTCTTGTTGTGCCCCTTTCCAAGATACAGCCTGCAAGTGGTAGCAAGAAGTGATTAGAGGCAGATCTGGACTTGGCAACAGAAGTGGTTTCCCATCTCCATTGTCTGAGTCTGATTTTCGCTGATGCTGTTTTGTGGATTTTTGTGGTAGTGATGGTTGTCAGTGCTGCCAGTTTCCCAAAACGTAATCAAGCCTCTGGTCACATGGCTGTCGATGTAGGCATTCTGGAGTGGTGTTCAGCCAAGTGACCGGGCAAAATTGGGCTGTGAAATTGTACTTCCAGGCTTGGATGTAATTTTTGCTCTAGAGAGAAGCAAGTGGTGGGAAGGAGGTAGCATGACGTGTGGTGTGCGGGTTTCCTTGCTGCCGTCACCTCTCCGCTCATACAGGAATGAAGCCTTAGCCAGGAGGCCAGGCTCAGCCCTGTGCCACTCACCGAAGCCACTTTCTACAGGCCAGCAGGGGCTTGTTGCAGGCTGTGGGTTTTGGTGTGGTTTGTCAGAGGCTAATTCTGCAGAGTTTCCAAAACCAGAAGACATCGTATGCTTGGGATGGGGGCCGTGCCACCCGTGGGAATGCTGCCCGCTCTGCAGACTGCTGCTAGAGCCAGCAACTCCACTAAGGTGGATTTTCATCAGGGGCCTGCAGGGCCCTCCCTTTTCCCATTGTTCCTGCGCTGCAAATTGCAGGCCCCAGCAATCGTGACTGACGTTTGCTCCTTGACTCCAAGAAACTGAGACCAAAGAAGCTGCTGTTCTTAGCAAGATGCGCACTGCATTCCACAGGTGGGAGGAGTCGGAGAGGCAGGGGCTTGCTTTGCAGCCCCACAGACAACAGTTGCACAGTGCCTCAAGCCCCAGAGTGGCTCACCCTGTCCAGACCTTTGAGGATATCAAAGGACAAAGTGCCCAAGTCTTTCCTACCTTGGGGGAACCTGGAACTTGGAAAGGCTCCCTGTCCTAGTCTTGATCTGTTCTGGGCCAGGTCCCAGCTTGAGCTGCCTCTGAGATTTGGGCTGTGCGGATCTCTGGAGTGAGCTCTGTTTCGGTTGACCCAGGTCATGGAATGGAAACGGTGAGGCCCCAGTGGCTGTTCTGGAAGAAACAGATCTCCTGGCAAAGGCCCCAGCATCTCCCTCACTGAAACCAGGTGGCCGGCTCCTCGGACTCTGCTTTATGTTGCGGTGAGAACTCTGCCCAGGTGTGCAGGGTTTGGCTTGTGGGCTGCTTGCTGCTCATCTGATTTTTGTCCCAGTAGTCCCTGCGTTCTTCATTCAACCCCTTCTGGGACTTCAGCTCAGAGAGCACCATCCCGGGGGTCAGGGCCTCCCCACAGGAGCCCTGCAGTGTGGTAGCGCCATGGCTGTCTCAAACCAAGCAAAGGAAGGACCCTGAGGCCTTCACGCTAACCGTCCTCGAGCAACTGCTGTTGGAAGGCCTCCCTGGGCCTGGCCCCCACCCTCTGCCACCCAGTCCTCCCAGCTGCCATGTTTCAAAGACGACCTTTACCTCCTGCCTTTGGATTGACTCTGCATTTGACCACGGACTCCAGTCTGTGTGTAGGGAGAGAGCTGAGTAGGAGGCCTCCACTCCGGATCGAGGCCTGTATAGGGCTCGTTTCCCCACACATGCCTATTTCTGAAGAGGCTTCTGTCTTATTTGAAGGCCAGCCCACACCCAGCTACTTTAACACCAGGTTTATGGAAAATGTCAGGCCTTCCCCACAACTCCTGTCTAACTGCTGTCGCCCCCCTACTTGCTGGCTCTCAGAAGCCTAGGGGAGTCCCTGTGGTCCTGAATTCTTTCCCCAAAGACGACCAGCATTTAACCAACCTAAGGGCCCAAAGGCCTTGGACAACTGCATGGAGCTGCACTCTAGGAGAAGGAGGGGAACCAGATGTTAGATCAGGGGAGGGAGCAGGAGTGTCCCTCCCGTCAGTGCCTACCCACCTGTGAGGCAGCCTTCTGATGGCCTGGCCCACCTTCCCCAGAACCAGGGGAGGCCTGAGGCTTCAGTTTTACTCTGCTGCAAAATGAAGGCGGGCCTGCAAGCCGACTACACCTACGGAGGCTGTTGAGGACAATTTCATTCCATTAAATTAAAAAATACTGACTGGCTGGCAGGCAGGTGCCATGTCTGGGAACAGGGACGGGGGAGCTTCACCTTTTTGTCTTGGCTTTTCTTTGGGCTGTGGGGGGGCATCCATTTCCAGGGTCGGGGAGGAAATACCAAATGCATTGTTGTTCTGCTCAATACATCTCACTTGTTTCTAATAAAGAAAGCAGCTGAACAAAACCTTCTGTCCTGGTATTCCTGGTCA