Transcript asmbl_177135

Sequence
Transcript Sequence for observation asmbl_177135 of TGE0000763:
GCGGGCAGGCGGCGGGGGCGGGGCCTGGAGGAGCCTACACCGACTCTGGAGGAAGACTGGAGCCTTTGCGGCGGCGCTGCCCCTCCCCTGGTCCCCGCGAGCTCGGAGGGCCCGGCTGGTGCTGCGGGGGCCCCGGGAGGTTGAAAACTAAGCATGGGGAAGAGCTGCAAGGTGGTCGTGTGTGGCCAGGCGTCTGTGGGCAAAACTTCAATCCTGGAGCAGCTTCTGTATGGGAACCATGTAGTGGGTTCGGAGATGATCGAGACGCAGGAGGACATCTACGTGGGCTCCATTGAGACAGACCGGGGGGTGCGAGAGCAGGTGCGTTTCTATGACACCCGGGGGCTCCGAGATGGGGCCGAACTGCCCCGACACTGCTTCTCTTGCACTGATGGCTACGTCCTGGTCTATAGCACAGATAGCAGAGAGTCTTTTCAGCGTGTGGAGCTGCTCAAGAAGGAGATTGACAAATCCAAGGACAAGAAGGAGGTCACCATCGTGGTCCTTGGCAACAAGTGTGACTTACAGGAGCAGCGGCGTGTAGACCCAGATGTGGCTCAGCACTGGGCCAAGTCAGAGAAGGTGAAGCTGTGGGAGGTGTCAGTGGCGGACCGGCGCTCCCTCCTGGAGCCCTTTGTCTACTTGGCCAGCAAGATGACGCAACCCCAGAGCAAGTCTGCCTTCCCCCTCAGCCGGAAGAACAAGGGCAGCGGCTCCTTGGATGGCTGAAGAGCTGCCGTTCCTCTTTCACGATCCCAGCCCCATTTCAGTGTCTGGGGCTCTGGTAGATGTGTTGAGGGCAAAGTAGAGGACAAGCTGTCTTTCCCAGTCAGCCAGGGAGCTCCCCGCCAGGCCACGCCCCAGCCACTTTGCTCCCTCTCACCTCTGGGAAGTGCAAATACTCTTGGTTGACATCCCCTTCCTCAGCCCTCCCAGCCTACTCCCCATCCCAGCTTTTAGAGGATCTGCTCCACTGTCTCCTGGGGCAGTTGTGGGTCACTGTCCCTTCCAGCTGCCCCAGACAGGAAGCAGAGTCACCACGCAGCAGTGTCCCTTCTTGGGTCTGAGTTCCTATTATAGGTAGGGGCCCCACCCTCTGGGCTTCCCATCAGCGACACACACACACTTATGGCACCAGCCTGGACTCCAGAAAAAGGGTGTCCAGGTATTGTGTGTATGCATTTAGTTGTGCACACACAAATATGCTCCTATACTGGCATTAGGCGTCTCCTCATCCCTCACCCTGACCTTTCTCCTGTCCTTTTCTTGGCTGGAAGAAGTTGGCCTCCTGGGAGTGTAGTTTTCTGTTTTAAATCCCCCACCCCTGGCTGGGCTCAGTGGCTCACCCCTGTAATCCCA