Transcript asmbl_177008

Sequence
Transcript Sequence for observation asmbl_177008 of TGE0000759:
CTGATATTTGACTTTTATCATTTCAGGCCTATATGGAGGCTATGAGTGAGTTTAGTGTGGCAGAAGATGAAAGAACCGGACAGGAATACGGACGAAATTGGAGCAGGGTTTGGGCTCTCCCCTTCGCAGATAATGGGAGGAGCCGGGCCCGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGACCCCAATGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGATGGGCTGATCATCCGCAAGCCTGTGACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACATGGGCATAGGTAAGCGGAAGGGTACAGCCAATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGAGGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATCGATCGCCACATGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAACACATCCACAAGCTGAAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGCCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAAAACCTCCCACTTTGTCTGTACATACTGGCCTCTGTGATTACATAGATCAGCCATTAAAATAAAACAAGCCTTAATCTGC