Transcript asmbl_145424

Sequence
Transcript Sequence for observation asmbl_145424 of TGE0067531:
CAGCAGCAGCGGTAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCTCCCTTACAGCTGTGTCTGCCATGAGCAGCACCTCAGCTGTGGACCCCTCCTTGACCAGGCCACCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGCCTGACAATGAGCAGCAGTGGCAGCCTTCAGGCAAGCCCGCGTGGCCTCCTGCCTGGCCTGCTCCCAGCCCCAGCTGACAAACTGACTCCCAAGGGGCCGGGCCAGGTGCCTACTGCCACCTCTGCACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAAGCCTCCCCTAGCCGCACTCGTTCCCCTGATGTCATCTCCTCAGCTTCCACTGCCCTGTCCCAGGACATCCCTGAGATTGCATCTGAGGCCCTGTCCCGTGGTTTTGGCTCCTCTGCACCAGAGGGCCTTGAGCCAGACAGTATGGCTTCAGCCGCCTCGGCACTGCACCTGCTGTCCCCACGGCCCCGGCCAGGGCCCGAGCTCGGCCCCCAGCTCGGGCTTGATGGAGGCCCTGGGGATGGAGATCGGCATAATACCCCCTCCCTCCTGGAGGCAGCCTTGACCCAGGAGGCCTCGACTCCTGACAGTCAGGTTTGGCCCACAGCACCTGACATTACTCGTGAGACCTGCAGCACCCTGGCAGAAAGCCCCAGGAATGGCCTTCAGGAAAAGCACAAGAGCCTGGCCTTCCACCGACCACCATATCACCTGCTGCAGCAACGTGACAGCCAGGATGCCAGTGCTGAGCAAAGTGACCATGATGATGAGGTGGCCAGCCTTGCCTCTGCTTCAGGAGGCTTTGGCACCAAAGTTCCTGCTCCACGGCTGCCTGCCAAGGACTGGAAGACCAAGGGATCCCCTCGAACCTCACCCAAGCTCAAGAGGAAAAGCAAGAAGGATGATGGGGATGCAGCCATGGGATCCCGGCTCACAGAGCACCAGGTGGCAGAGCCCCCTGAGGACTGGCCAGCACTAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAGGAAGAGCTGCTGCAGCGTCTGTGTACCCAACTCGAAGGCCTGCAGAGCACAGTCACAGGCCACGTAGAACGTGCCCTTGAGACTCGGCACGAGCAGGAACAGCGGCGGCTGGAGCGAGCACTGGCTGAGGGGCAGCAGCGGGGAGGGCAGCTGCAGGAGCAGCTGACACAACAGTTGTCCCAAGCACTGTCGTCAGCTGTAGCTGGGCGGCTAGAGCGCAGCATACGGGATGAGATCAAGAAGACAGTCCCTCCATGTGTCTCAAGGAGTCTGGAGCCTATGGCAGGCCAACTGAGCAACTCAGTGGCTACCAAGCTCACAGCTGTGGAGGGCAGCATGAAAGAGAACATCTCCAAGCTGCTCAAGTCCAAGAACTTGACTGATGCCATCGCCCGAGCAGCTGCAGACACATTACAAGGGCCGATGCAGGCTGCCTACCGGGAAGCCTTCCAGAGTGTGGTGCTGCCGGCCTTTGAGAAGAGCTGCCAGGCCATGTTCCAGCAAATCAATGATAGCTTCCGGCTGGGGACACAGGAATACTTGCAGCAGCTAGAAAGCCACATGAAGAGCCGGAAGGCACGGGAACAGGAGGCCAGGGAGCCTGTGCTAGCCCAGCTGCGGGGCCTGGTCAGCACACTGCAGAGTGCCACTGAGCAGATGGCAGCCACCGTGGCCGGCAGTGTTCGTGCTGAGGTGCAGCACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCCATTTTAGCACAGGTACAGCGCATCGTTAAGGGTGAGGTGAGTGTGGCGCTCAAGGAGCAGCAGGCCGCCGTCACCTCCAGCATCATGCAGGCCATGCGCTCAGCTGCTGGCACACCTGTCCCCTCTGCCCACCTTGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCGCTGACAGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGCCCAGGTTTTTGGGCAGCCACCCTGCCCGCTCTCCCAGCCTGTGCTCCTTTCCCTCATCCAGCAGCTGGCATCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCCGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGCTCCGTTATGGCCCAGGTGCGCCAAAAGCTTTTTCAGTTCCTGCAGGCTGAGCCACACAACTCACTTGGCAAAGCAGCTCGGCGTCTCAGCCTCATGCTGCATGGCCTCGTGACCCCCAGCCTCCCTTAGCTGCTAAGCCTGCCTTGCCCAGGGGTGGGATGGCACTGAAGGCCAGCAGACAGGCCTAGGCTGGGGCAGGGTCACGGCTGGCCTTTACCTGCTCAGGCCCCCATCTCTGGGGTGTTTGGGGGTCAGGGAGCAGGGAGCACTGGCCGTGGTCTACAGCGTGTGGTAGTCAGAAGGTTTAGCTGGGCCCAGGGCAGGTATTGCGCCTGCTTGGGTTCTGCCATGCCTGGAGCATGACCCTGAGATCGTGACACCACTTGAGTGGAATTTTCCATGTTCCTTTTTACCTCTAATTTGGATCTTTTTGTTTTTGAAAAACATTGAGAAATTCAATTAAATGCTTTTGGAATAAAATGGAGTATGTGTGTGCTTTTGGTTTGTCTTTGGTGTGACTCTCATAACTGCCGTCTGTTCGTTCTCTG