Transcript asmbl_144106

Sequence
Transcript Sequence for observation asmbl_144106 of TGE0000584:
GTGTGTGTGTGTGTGTGTGTGTGCACTTGAGTGTGGAGACTTTTGTGTTCCTCCTACCTGACCTGAACTGTTGAATGATGAAGTTACAATGATTGGACTCAGGGGTGCAGCTAGCTAACTTGGGAATTGGGGTTTTGAAGTACTGGAGACAGCTTTGTATGCCATGTTAATGAATTTGAATTTTATCCTGAAAAACGTGGCTGTCGTTGAAGAATTTTAAGCAGGCAGGTGGCTTGATCAGAGCACTGCTTCCCAGATTTCACTCAATGGTACCTGTATAACACATTCATGATTTTTGCTGTATCTCCGTATCATCAAGTTACTTAACGTTTTTACACCAACTTTTATTATTTTATAAATGTACTTAAAGAGGAAATTCACTACTAGCATTGCTTGCCATAATCAAAATAAATATATTATTAAAATGGAACAGTGCTAAATAAGGTGTACACATGGACATAGAGTGTGGAATGACAGACAATGGAGACTCCGAAAGGTGGAGGGGTGGGAGAGAGGTGAACGATGAGAAAGTACTTAATGGGTACCATGTACATTATTCGGGTGATGGGTACACTAAAAGCCCAGACTTCACCATTACTGCAATATATCCATATAACATAACTGTACTTGCGCCCCTTAAATTTATACAAATTTTTAAAAGGAAAAAATGGAAGTGTTCATCTATGTACCAACTTAAAATCATCTCACGCACCACTAGTGTTAAATCTACCACATGTGGGGAAACTGTGTGGTATGAATTGGGTTGAGGGCGTCCCCAGCAGGCACAGAAATTGGGTTGGTGCCAGGTTCTTAATGCCCAGATCTTAATTAGAGAGCCCAAGTCCGTTGTAGGCCTGGAGCAATTCAGACACAAGGCAAAAAGAAAGTACATTTGCCTATGCCTTGTAACGTCTACACCACCAGCCTTTCTGAAACTATTGTGCATACGAAGTCATCCCAGGATCTTGTAAAAACACCGATTCGGATCCAATATGGGACCTGGAGTTCATACATTTCTAATCAACTCCTAAATGATATTGATGCTGATACTGTCGGTTTCCCAACCAAGCAACGTAGCAAGGTACGAAACTCTAAAGTCCCTAAAGGGCAGGGACCACGCCTCTCGCGTTGGCATAGTGCCTAGCTCAAGGCACTTTCTGGGTTAACACTCGCTGAGGACCGGAGTGAACGCCCCCGCCCCAAGTCGTCACGTGACTGACTTTCTCCAACTGCCGGTTTCGGCTCACATAACACACCTACTATCCAAAACATTTCTATTTTCCTAACACAAAAACTATAGCTAAGTTTTTATATTCTATGTAGCCCCAGCCTAGGACGTAAATTCCACGAGACCAAAAGCCTTGTGATGATTCCCCGAGGTTGCTGACCCTCCCGGTGTGTCCCGGGCCTGCTCTGGGGGACACAGCGGCGAATACGTTGAACGAGGCCCCTGTTTCACGGAGCTAAAGATCCAGTAAGGACTTCACCCAGCGAGAGGCAACTACGCCGGGCTTCGATACCCAATACCTCTGCAGAAAGGTGGAGTGGCAGGAATCTCCTGAAGCCTCCAACGTCCAGGAACGCGGAAACCCAGGGCCTCCAGTGCAGGTGTCATCCCGGAGGGCGCATGCGGAGTCCCAAGAGAGGCGCGTCCCATTGGACAATGCTGAGCGGAAGAGCCCAAGATAGCGGGGGGAGTTGTGACAGGCTGCTGCAGACGTACTTAGAAAAGGGGTGCATACTGGATATTCAGGCTAGGAGAAGAACGCAAAAAGCAGTGACGTACATTATTCTCTGCATATATTTACTTGGGAAATTGTGCGTCTCCCTATTCTGAGTCTTGGAGGAATTGGACTGGTCCAACCTTATAAAGAGAGCAGTAGAGCGCGGCAGTATAGAGAGTACCTCACGAAGGGGACGTGGGAAAGTGTTAGCGGGGAACGCTGGGAAACTCCCGGCCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAGCTACTAACCAGAGCCGGCTCTTTCTCGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGTTAAAGCCACAGCTGCGCCTGCAGGAGCACCGCCACAACCTCAGGACCTTGAGTTTACCAAGTTACCAAATGGCTTGGTGATTGCTTCTTTGGAAAACTATTCTCCTGTATCAAGAATTGGTTTGTTCATTAAAGCAGGCAGTAGATATGAGGACTTCAGCAATTTAGGAACCACCCATTTGCTGCGTCTTACATCCAGTCTGACGACAAAAGGAGCTTCATCTTTCAAGATAACCCGTGGAATTGAAGCAGTTGGTGGCAAATTAAGTGTGACCGCAACAAGGGAAAACATGGCTTATACTGTGGAATGCCTGCGGGGTGATGTTGATATTCTAATGGAGTTCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGTTGGGAAGTAGCTGACCTTCAGCCTCAGCTAAAGATTGACAAAGCTGTGGCCTTTCAGAATCCGCAGACTCATGTCATTGAAAATTTGCATGCAGCAGCTTACCGGAATGCCTTGGCTAATCCCTTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAGGAGTTACATTACTTCGTTCAGAACCATTTCACAAGTGCAAGAATGGCTTTGATTGGACTTGGTGTGAGTCATCCTGTTCTAAAGCAAGTTGCTGAACAGTTTCTCAACATGAGGGGTGGGCTTGGTTTATCTGGTGCAAAGGCCAACTACCGTGGAGGTGAAATCCGAGAACAGAATGGAGACAGTCTTGTCCATGCTGCTTTTGTAGCAGAAAGTGCTGTCGCGGGAAGTGCAGAGGCAAATGCATTTAGTGTTCTTCAGCATGTCCTCGGTGCTGGGCCACATGTCAAGAGGGGCAGCAACACCACCAGCCATCTGCACCAGGCTGTTGCCAAGGCAACTCAGCAGCCATTTGATGTTTCTGCATTTAATGCCAGTTACTCAGATTCTGGACTCTTTGGGATTTATACTATCTCCCAGGCCACAGCTGCTGGAGATGTTATCAAGGCTGCCTATAATCAAGTAAAAACAATAGCTCAAGGAAACCTTTCCAACACAGATGTCCAAGCTGCCAAGAACAAGCTGAAAGCTGGATACCTAATGTCAGTGGAGTCTTCTGAGTGTTTCCTGGAAGAAGTCGGGTCCCAGGCTCTAGTTGCTGGTTCTTACATGCCACCATCCACAGTCCTTCAGCAGATTGATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCAGAGCAGCAAACACATGAAAGTCAGAAGTCTCTAATATATCATTTGTCTTTTTTCCAGTGAGGTAAAATAAGGCATAAATGCAGGTAATTATTCCCAGCTGACCTAAAGTCAATAAAACATTCTGTTTAAGTGTTTTTCTTACGTTTTTCTCAATGAGTTAATCAACAAGTATTTATTATGTGCTGATATCTTTGTTTTAGATGCTTTAAAGGAGACAGGAATATAATTATTGAGTATAGAAGCATCAGAAACTATTAAAATTAAGGCTAAGTGGCTATCGGGGTAAATAGTGCCAGATTACTATTGGTGGCGTTTAAGATGAAAGCAAGTTCAAAATTTGTCATTTTGGGTGTCAACAGCTAAATGGTCTGGTTTTTACCCCTGTTTTGCCTTTTTTGCAATAAAATTATTTCCAAAAAACATACATTTCCTATCAATCATATCCTATATTCCCATTCATTCATTT