Transcript asmbl_141958

Sequence
Transcript Sequence for observation asmbl_141958 of TGE0000502:
GCTCCACTCCGCCAGGGGGCGCTGTGTGGCTCCCGAGTAGGCTCAGAGCGACCGTGGCCGGGCGGAAGCGGCTTTCTGGCCTAAGCTTTAACAGGCTTCGCCTGTGCTTCCTGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGGTTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAAT