Transcript asmbl_140384

Sequence
Transcript Sequence for observation asmbl_140384 of TGE0000514:
TGACTTCAGGTGATCCGCCCACCAATTCTTAACGCTGAGTCAGTATGGGCTTTCCTTCAGCCCCATAAAGTGCACCTCAGAGGTCAGGGAACACATAACAAGGACATTCAAAAGGGGAGCGCGCGGAAGTGGCTTTAGGAAGCACTAAGTCTTGCCTGGTTTTTTTTCCTCCCTGCTTTTCTAAATCCAAACCCGGACTCCTCAACCCACAGCACCACCAATTTCCAGGGCGGAAATGACGTCGTATTCACGCGCCGGAAGTGCATTTGCAGAGTGAGACAAAGCGGAGAACGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAGAAGCATCGAGGCTATAGGACGCAGCTGTTGCCATGACGGCCCAGGGGGGCCTGGTGGCTAACCGAGGCCGGCGCTTCAAGTGGGCCATTGAGCTAAGCGGGCCTGGAGGAGGCAGCAGGGGTCGAAGTGACCGGGGCAGTGGCCAGGGAGACTCGCTCTACCCAGTCGGTTACTTGGACAAGCAAGTGCCTGATACCAGCGTGCAAGAGACAGACCGGATCCTGGTGGAGAAGCGCTGCTGGGACATCGCCTTGGGTCCCCTCAAACAGATTCCCATGAATCTCTTCATCATGTACATGGCAGGCAATACTATCTCCATCTTCCCTACTATGATGGTGTGTATGATGGCCTGGCGACCCATTCAGGCACTTATGGCCATTTCAGCCAAGAATGGAGTTCAGTGGTGGAGGACTGCTTTTGTGAACATGAGAAAGCAGCGCCTGGTCCCTATGTATTTGGGTCTTATTTACATCCTTCTTTAAGCCCAGTGGCTCCTCAGCATACTCTTAAACTAATCACTTATGTTAAAAAGAACCAAAAGACTCTTTTCTCCATGGTGGGGTGACAGGTCCTAGAAGGACAATGTGCATATTACGACAAACACAAAGAAACTATACCATAACCCAAGGCTGAAAATAATGTAGAAAACTTTATTTTTGTTTCCAGTACAGAGCAAAACAACAACAAAAAAACATAACTATGTAAACAAGAGAATAACTGCTGCTAAATCAAGAACTGTTGCAGCATCTCCTTTCAATAAATTAAATGGTTGAGAACAATGCATAAAAAAAGTTGCACAAGTTCCTTATTTTCCTTAATATTTCACTTCTATTTAATACAAGCTGGGACATAAAAATTCTGTTGGGGATACCTGGGGGAAGATGTGAGAAACTAATGCTGAATTCAGCTTATACATGATGAAAAGAAAAACCAGACAAAAGGAGCACATAAATATGCATACAGTGTAACTGTTATTATTTTAATACCCACGATAAGGGATTTTTGTTAGCATGTTTAGGGGGAACGAGGATTGGTGGGATCCTTGGGCCACAGGAATCTGAGGCAACGGAAGATATATAGAGTGATCGTCCCCCTGCCGAAGGAACCTGGCACCTGTCAAGCAGATGCTGCAGTTCAAACTTCAGCTTTTAAGATAGATAGCTATTGAAGGCAGAGGGTCAGCAGGAGGATGTGTATTTCTAATCTACCCTGGTAAAGTCATAGGTAAGACTCAAAAGCGGGATCTTATTCAAAAGGCAGGTATTTCCTTTGTTTTCTGTCTTGAAATAGCCCCTTCCCCTAAGGTGCATTCTCTCAAGTTTTCAGTATTGCTTTATTTGCAGTGATTAAAAGAGATGAGAGACTTTGGAGACAGACAACGTAAGCAACACATACACACATGAAATACTCTAGACAGACATGAATATAAATCTGGCCTAATAACCAGTTTTCCATGTAACAGTGATTTTGTGTTTCGGGCTGAAGCAGTGGTTATATTAAAAGCCACTAATTCCCTTATCCCTTTAAAAGATTTTTACAATTCTCCAACCACAAACAGCACTTCTAAAACTAACTTTACTTTCTGCCCATAATTTGTTCTACATGGAAAAAAAAAATATTACTTTGGCCAGGGGTGTGTGTAAATGTGGCAGAATTCCTAGGCAGGCTGACCTTTACAGTATGGGCCTTTAAGATACTGGATCCTGGTTGGGCACAGTGGCTCACGCCTGT