Transcript asmbl_140383

Sequence
Transcript Sequence for observation asmbl_140383 of TGE0000513:
TGACTTCAGGTGATCCGCCCACCAATTCTTAACGCTGAGTCAGTATGGGCTTTCCTTCAGCCCCATAAAGTGCACCTCAGAGGTCAGGGAACACATAACAAGGACATTCAAAAGGGGAGCGCGCGGAAGTGGCTTTAGGAAGCACTAAGTCTTGCCTGGTTTTTTTTCCTCCCTGCTTTTCTAAATCCAAACCCGGACTCCTCAACCCACAGCACCACCAATTTCCAGGGCGGAAATGACGTCGTATTCACGCGCCGGAAGTGCATTTGCAGAGTGAGACAAAGCGGAGAACGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAGAAGCATCGAGGCTATAGGACGCAGCTGTTGCCATGACGGCCCAGGGGGGCCTGGTGGCTAACCGAGGCCGGCGCTTCAAGTGGGCCATTGAGCTAAGCGGGCCTGGAGGAGGCAGCAGGGGTCGAAGTGACCGGGGCAGTGGCCAGGGAGACTCGCTCTACCCAGTCGGTTACTTGGACAAGCAAGTGCCTGATACCAGCGTGCAAGAGACAGACCGGATCCTGGTGGAGAAGCGCTGCTGGGACATCGCCTTGGGTCCCCTCAAACAGATTCCCATGAATCTCTTCATCATGTACATGGCAGGCAATACTATCTCCATCTTCCCTACTATGATGGTGTGTATGATGGCCTGGCGACCCATTCAGGCACTTATGGCCATTTCAGCCACTTTCAAGATGTTAGAAAGTTCAAGCCAGAAGTTTCTTCAGGGTTTGGTCTATCTCATTGGGAACCTGATGGGTTTGGCATTGGCTGTTTACAAGTGCCAGTCCATGGGACTGTTACCTACACATGCATCGGATTGGTTAGCCTTCATTGAGCCCCCTGAGAGAATGGAGTTCAGTGGTGGAGGACTGCTTTTGTGAACATGAGAAAGCAGCGCCTGGTCCCTATGTATTTGGGTCTTATTTACATCCTTCTTTAAGCCCAGTGGCTCCTCAGCATACTCTTAAACTAATCACTTATGTTAAAAAGAACCAAAAGACTCTTTTCTCCATGGTGGGGTGACAGGTCCTAGAAGGACAATGTGCATATTACGACAAACACAAAGAAACTATACCATAACCCAAGGCTGAAAATAATGTAGAAAACTTTATTTTTGTTTCCAGTACAGAGCAAAACAACAACAAAAAAACATAACTATGTAAACAAGAGAATAACTGCTGCTAAATCAAGAACTGTTGCAGCATCTCCTTTCAATAAATTAAATGGTTGAGAACAATGCATAAAAAAAGTTGCACAAGTTCCTTATTTTCCTTAATATTTCACTTCTATTTAATACAAGCTGGGACATAAAAATTCTGTTGGGGATACCTGGGGGAAGATGTGAGAAACTAATGCTGAATTCAGCTTATACATGATGAAAAGAAAAACCAGACAAAAGGAGCACATAAATATGCATACAGTGTAACTGTTATTATTTTAATACCCACGATAAGGGATTTTTGTTAGCATGTTTAGGGGGAACGAGGATTGGTGGGATCCTTGGGCCACAGGAATCTGAGGCAACGGAAGATATATAGAGTGATCGTCCCCCTGCCGAAGGAACCTGGCACCTGTCAAGCAGATGCTGCAGTTCAAACTTCAGCTTTTAAGATAGATAGCTATTGAAGGCAGAGGGTCAGCAGGAGGATGTGTATTTCTAATCTACCCTGGTAAAGTCATAGGTAAGACTCAAAAGCGGGATCTTATTCAAAAGGCAGGTATTTCCTTTGTTTTCTGTCTTGAAATAGCCCCTTCCCCTAAGGTGCATTCTCTCAAGTTTTCAGTATTGCTTTATTTGCAGTGATTAAAAGAGATGAGAGACTTTGGAGACAGACAACGTAAGCAACACATACACACATGAAATACTCTAGACAGACATGAATATAAATCTGGCCTAATAACCAGTTTTCCATGTAACAGTGATTTTGTGTTTCGGGCTGAAGCAGTGGTTATATTAAAAGCCACTAATTCCCTTATCCCTTTAAAAGATTTTTACAATTCTCCAACCACAAACAGCACTTCTAAAACTAACTTTACTTTCTGCCCATAATTTGTTCTACATGGAAAAAAAAAATATTACTTTGGCCAGGGGTGTGTGTAAATGTGGCAGAATTCCTAGGCAGGCTGACCTTTACAGTATGGGCCTTTAAGATACTGGATCCTGGTTGGGCACAGTGGCTCACGCCTGT