Transcript asmbl_129058

Sequence
Transcript Sequence for observation asmbl_129058 of TGE0000498:
AAATTTCCAACTACCACTCCTCTGGAAGCAGGACCTGGCTTCCTCCCTCCTCTCTCCGCCCACCCTCGTCGGCGTCTGCCCCGCGCCCGCCATAGCGACGGCAACGGGCGCTGCGGAGTGCTCCGAGCCGTGAGGGCGGGGCCGGCGCGATGCCCCGCCCCTTCGATAGCTCATCTTTGCGCGTCGCAGTCGCGCGGAGCCCGGCTTCCGACGTGCAGCCTGGCAGTGCAGTGAGCTGTCTGGCCTTTTGTCCTTGATCCTTGGTTAAGGAAATGACCAACCAGTACGGTATTCTCTTCAAACAAGAGCAAGCCCATGATGATGCCATTTGGTCAGTTGCTTGGGGGACAAACAAGAAGGAAAACTCTGAGACAGTGGTCACAGGCTCCCTAGATGACCTGGTGAAGGTCTGGAAATGGCGTGATGAGAGGCTGGACCTACAGTGGAGTCTGGAGGGACATCAGCTGGGAGTGGTGTCTGTGGACATCAGCCACACCCTGCCCATTGCTGCATCCAGCTCTCTTGATGCTCATATTCGTCTTTGGGACTTGGAAAATGGCAAACAGATAAAGTCCATAGATGCAGGACCTGTGGATGCCTGGACTTTGGCCTTTTCTCCTGATTCCCAGTATCTGGCCACAGGAACTCATGTCGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGGAAAAAGGAATATTCTTTGGACACGAGAGGAAAATTCATTCTTAGTATTGCATATAGTCCTGATGGGAAATACCTAGCCAGTGGAGCCATAGATGGAATCATCAATATTTTTGATATTGCAACTGGAAAACTTCTGCATACCCTGGAAGGCCATGCCATGCCCATTCGCTCCTTGACCTTTTCCCCGGACTCCCAGCTCCTTGTCACTGCTTCAGATGATGGCTACATCAAGATCTATGATGTACAACATGCCAATTTGGCTGGCACGCTGAGCGGCCATGCCTCCTGGGTGCTGAACGTTGCATTCTGTCCTGATGACACTCACTTTGTTTCCAGTTCGTCTGACAAAAGTGTAAAAGTTTGGGATGTTGGAACGAGGACTTGTGTTCACACCTTCTTTGATCACCAGGATCAGGTCTGGGGAGTAAAATACAATGGAAATGGTTCAAAAATTGTGTCTGTTGGAGATGACCAGGAAATTCACATCTATGATTGTCCAATTTAAACATCAAAGTCTCCAGGCTTATGCTGCAAAGAGAATGTACGGATTGATCATGACATTCCTTACCTTCTTAGGCTTGTTTAAAAGAAATATAGCATTTATTGTAGCAAAGACTTAAATTTTGTAGATACAATATGAATCTTTTCATGTTTTATTGGAAATGCTGTTCATACTTTAACATAAAGCTTTCTTAATGCAAACACTGGTGTCCTTGAACATGCTTCTTTTTTCAGTTACCCTATTACCAGTGAAACAGTGAGAGGGATTGGCATTAAG