Transcript asmbl_129016

Sequence
Transcript Sequence for observation asmbl_129016 of TGE0000497:
CGCCCAATGGGCAGGCGGAAACCGCGGGCTCGTGCTCCCGGCCTAGGGCGTCTTATCTCGTTCGCGCGTCTCGCGAGCATTAGGTGACTGGCTGAGGCGGCGCCAGTTGGCCGGGCACGGGGCTGCTGTAAGGCCGAGGTTGCGGCGGAAGCGGAGACCATGTTCCGAGCGGCGGCTCCGGGGCAGCTCCGGCGGGCGGCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAGAACCTTTTGCCCAGAGTAGCAGCCAAACTTGAGGTTGCCCCGATTTCTGACATCATTGCAATCAAGTCACCTGACACATTTGTGAGAACTATTTATGCAGGAAATGCTCTATGTACAGTGAAGTGTGATGAGAAAGTGAAAGTGTTTTCTGTCCGTGGAACATCCTTTGATGCTGCAGCAACAAGTGGCGGTAGTGCCAGTTCAGAAAAGGCATCAAGTACTTCACCAGTGGAAATATCAGAGTGGCTTGACCAGAAATTAACAAAAAGTGATCGACCAGAGCTAACAGGTGCCAAAGTGGTGGTATCTGGTGGTCGAGGCTTGAAGAGTGGAGAGAACTTTAAGTTGTTATATGACTTGGCAGATCAACTACATGCTGCAGTTGGTGCTTCCCGTGCTGCTGTTGATGCTGGCTTTGTTCCCAATGACATGCAAGTTGGACAGACGGGAAAAATAGTAGCACCAGAACTTTATATTGCTGTTGGAATATCTGGAGCCATCCAACATTTAGCTGGGATGAAAGACAGCAAGACAATTGTGGCAATTAATAAAGACCCAGAAGCTCCAATTTTCCAAGTGGCAGATTATGGAATAGTTGCAGATTTATTTAAGGTAGTTCCTGAAATGACTGAGATATTGAAGAAAAAATGAATCAGGATCATGCCTTAAAAAGAAAACTTTTGTTAAAGTATTCCACTGAAATCACAGATATTTGTGGGTATTATAACAATCATTGGAAAGCATGGAGAGCTACATTTCATAATTTGAGGGAAAATTTCTAACAGATGCCAGAATGCTTGTTTATGGGATTGCTGTGTTTCCTTTTAATTATTTGTGGTTCCAAACAATTATTGTTTGAACTTTTTAAATTCTGTACTAAAATCTATAATAAAGCTTTTCCACAGCTTTAAAACTATCAGAAATATGCCTAGCCTCTAGAGAAAATTGAAGAAAAGGAGTAAAAATTTTGTTTATTTATTTATTTTTTTGCCTTTCTTGTTCATGGAGAGCTCTATGTTTTAGGAAGATTGTAAACATGATTGTCTCCACCAGCCTAATCAACCTACTAATCTCATTGTTGAAGGGCAAACTTCATAGGAGAAGGTAACTGAATTGGCAAGTGCAGAGTTAAAAAAGCACGGCTATAAAGCATGAATATTATCTTAAACATACTCCAGTCTTCAGAAGACCATAGCTAATGTGACAAAAGCAGACCTGACTTAAACCTGACCCAGCTCCATGTATTTAGTTGGCTTAAGGTAAATTTCATTTTCCGTTTAATTTTAAGGTTTTGTCAGTTTATAGGACTTTTGTCTGTAAAGGAGGGAGAGTGGAGGAGGGGCTGCTTTGAGACAGCATGGCCTCTGATGCAAGCAGATAGTTTGATGTTATTATAAACATTCAAAATCCTGTGCAGAGAATGCTCTAGCCTTTCTTTTGCCTTCTGTTGGCTTCTTTTGGGCTCTCTTAGGAAGCACCCAGGCCTGTGTAGTCACCTCTGGCACTCTCATTCTGCTGCCCAGGGCACAGCTGAGGTCCAAGAGTGTCACCAGGGCTGCAGCTGGTGTGGATGCAGGCCCAAGAGCAGAGGCTGGTGAGGCTTTGAACAGGCCTGCAGGAAGGCGTGGGTAGGTAGGTGAGTAGAACAAAGAGGGCTGCCCTCCTGAATCAGATCTGCAGAAGTAGGAGTAGTGACCTGGATCAAGCAGACAGTAGGGAAGAGAAGGGAAGTGATAAGTGATGGAGGTGGCTAGAGTGCCTTTGTGTGACCAGCCTGGGGCCCTTCCCCAGCTGACTAGTGAACCCTTTCTGATTTGTGTCACAATCAGTTGCTATAAAACACTTTTAAAAGTTGTATCTTTGGCATTTCAGTCTTCTTTTAATGAGATGAGAGGAGAGCAGTAGAATGATGCCTCTTTGCAAGTAATGTCTGTTAGAATAGAAGAATCCTAGAATGTCTGAGCCCGGTGATTATCTGGTCAGACCCCTTGTTGTATAGATGGGCATACTGAAGCACAGAGAAGTGAAGAAGGTAAAGTGACTTGGCCAAGGCCACATGGCTTGAATCACCTTTGGGAGAGTAATTCCTATGTCTTGTTTTTATCTGTGAGGTTCTTCCTAAGAGGGCTAACCTTGCTCAAGATTTTTTCCATTTACCCCTCATCCCTGTTGGATGCTATAACTGGGGGACAGGAGAGATGGCAAAGGTGATGGCCACAGAGGCACCCCCAGTAGAAGGTGTGCTGGCTCAGGGAGGGACATCC