Transcript asmbl_128671

Sequence
Transcript Sequence for observation asmbl_128671 of TGE0000491:
TCTTTTTTCCTTCTCAACAACTTCATGTTCTTTCACCACCTTAATAATCAAGCATTTCCTTCCCAACAACAACTAAAGGGACCAGGAAAGACTTACAGAAGAAAGTGAAAGATTTTTATCTCACTTCAAACAGAAATTTACTTTTAGGCTGTCACTGTCTCCTCCCAGCTTATCTGAGCTAACAGGAAGCGAATGAAGGCCTGTGATTCAGCTGCAGGCAGCGGGTATGCCTGAGCAGGTCACACCCATTTGGTCTCTTTTGCCAGGAAAATAAAAAAAGAACCTAAGAGAACGGTCTTCACATTTTGAATGCGCAACATTGTATCTGTGAATGAAGGCAAGAGTTAACAGCTGTTTAATTGATAACTGCTCGCATCATTAGTTGCTGGCTAACAACTGGGAAATCAGAAAATGTCTTGTAGAAAAATGTAAGAAAAGTTCCAACAATACTGACTTAAACACGACAAAGGTGAAAACAGAAATGCTGACTCCTGCATAGGTTATCGGCCCTAATGTTCTGACTTGATATTTCCAGATGCCCAGCTCTGCGCTAATATCAACACCGTCTATTTACTTTCTACTCTGAGGCATTCGCTCTGCAGGATTCCAGACCCTACTAAATTATTCACATGGCCCCAACCGGTCCTTCCTTGTTCCGCGGTCCTAACACAATGAATGGTCCTAAGAGGAAAACGGCCTCGCGCTCCCGCTCCAGGCCCACTTCGCAGTCCCTAGTTCTCCCTACTGCCGCTCCAGTGCCAGAGCCCCTCCGAAGGCGGCCAGGACCTCCAACCACGCACAAGTCTGCAGCTCTCCCCAACTTTCCGTTCAGCTCAGTCTCCGAGGGTGCGCCAGAGCAGACACCCGGAGGAGTGGGGAGTGGCAGGGCGGGGCCGGGAGAATGCTGCCCCGGAACCCATAAATCTGGGCCCTGCCCAGGTAGGCCGGGACAGCTGGGGTGGCCTGGGCCGAGAGCCAAGAAAAGACACCCCATCTGGCAGCCCAACTTGGCGGCAACAGGTGGCCCGGCGCCCGGGGGTCTGGGAGGAAAGTCGCTCCGGGGGCGGGCCCCGTTGCCCCGCCGCGTCCCCATTGGTCATCAGGTTTCTTAAAATGTGACTCTGAATCTGTGTCCTTCCGCCGCAGAATTTAGTCCCACCGAAAGGGCAACCTGCCCGCGCGTTCCGCCGCCGCCGCCGCGCTTCCTCCTGAAGGTGACTGCGCCCGCGGGGACGCAGGGGGCGGGGCCCGGGTCGCCCGGAGCCGGGATTGGGCAGAGGGCGGGGCGGCGGAGGGATTGCGGCGGCCCGCAGCGGGATAACCTTGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGGTCAGCGCCGGAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGATGGACCCCAGAGCCCCTCCTCCAGCCCCTGTCCCACCCCCTTCCCCCAGCCCATCCATTAGGCCAGCAACGCTTGTAGAACTCACTCTGGGCTGTAACGTGGCACTGGTAGGTTGGGACACCAGGGAAGAAGATCAACGCCTCACTGAAACATGGCTGTGTTTGCAGCCTGCTCTAGTGGGACAGCCCAGAGCCTGGCTGCCCATCATGTGGCCCCACCCAATCAAGGGAAGAAGGAGGAATGCTGGACTGGAGGCCCCTGGAGCCAGATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAAGAAACAGCCAGCAAGAGTTAGGGGCCTTAGGGCACTGGGCTGTTGTTCCATTGAAGCCGACTCTGGCCCTGGCCCTTACTTGCTTCTCTAGCTCTCTAGGCCTCTCCAGTTTGCACCTGTCCCCACCCTCCACTCAGCTGTCCTGCAGCAAACACTCCACCCTCCACCTTCCATTTTCCCCCACTACTGCAGCACCTCCAGGCCTGTTGCTATAGAGCCTACCTGTATGTCAATAAACAACAGCTGAAGCACC