Transcript asmbl_128209

Sequence
Transcript Sequence for observation asmbl_128209 of TGE0000477:
CGCCTCTGAGCCGCGGAGGATTGTGGGAGGAGGTTGTCTCCAATTTCTCCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTACGACCTGGAATACTCTGAAGATAGTAACTCCGAGCCAAATGTGGATTTGGAAAATCAGTACTATAATTCCAAAGCATTAAAAGAAGATGACCCAAAAGCGGCATTAAGCAGTTTCCAAAAGGTTTTGGAACTTGAAGGTGAAAAAGGAGAATGGGGATTTAAAGCACTGAAACAAATGATTAAGATTAACTTCAAGTTGACAAACTTTCCAGAAATGATGAATAGATATAAGCAGCTATTGACCTATATTCGGAGTGCAGTCACAAGAAATTATTCTGAAAAATCCATTAATTCTATTCTTGATTATATCTCTACTTCTAAACAGATGGATTTACTGCAGGAATTCTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGTGGTTTAAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAGGAATATGGAAAGCTTCAAAAAATTTTACGCCAGTTACATCAGTCGTGCCAGACTGATGATGGAGAAGATGATCTGAAAAAAGGTACACAGTTATTAGAAATATATGCTTTGGAAATTCAAATGTACACAGCACAGAAAAATAACAAAAAACTTAAAGCACTCTATGAACAGTCACTTCACATCAAGTCTGCCATCCCTCATCCACTGATTATGGGAGTTATCAGAGAATGTGGTGGTAAAATGCACTTGAGGGAAGGTGAATTTGAAAAGGCACACACTGATTTTTTTGAAGCCTTCAAGAATTATGATGAATCTGGAAGTCCAAGACGAACCACTTGCTTAAAATATTTGGTCTTAGCAAATATGCTTATGAAATCGGGAATAAATCCATTTGACTCACAGGAGGCCAAGCCGTACAAAAATGATCCAGAAATTTTAGCAATGACGAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTAAAAACAAATCACAGCAACATCATGGATGATCCTTTCATAAGAGAACACATTGAAGAGCTTTTGCGAAACATCAGAACACAAGTGCTTATAAAATTAATTAAGCCTTACACAAGAATACATATTCCTTTTATTTCTAAGGAGTTAAACATAGATGTAGCTGATGTGGAGAGCTTGCTGGTGCAGTGCATATTGGATAACACTATTCATGGCCGAATTGATCAAGTCAACCAACTCCTTGAACTGGATCATCAGAAGAGGGGTGGTGCACGATATACTGCACTAGATAAATGGACCAACCAACTAAATTCTCTCAACCAGGCTGTAGTCAGTAAACTGGCTTAACAGAGAACAAGCTTTTACAGACGTCCTTAAGGCAACAGTGCAGAGATGTAATCCTTAAAAGAACTGGGAATGGCAAAACTACTGTCGGTTGATGTGTCCTGAAAATTATTGGAGTTATGGCAGAAGTGCTTTTTTGATCAACTGGTTTGTGTTTTGCTGCTGCATTTATCCCAAGAAAAACAGCTTTAATCTCCAGAAGAAAACCAAAATACCATGGGATTTATGCTGTATTGACATCTTGCCCTAAACGTACAACATCATAGTAATTTGTCATGGGCAACATGACCAGAGAGAAGATTTTTGTCATGATTTTAAATACACTGACACGCTACTGTTGGTTAAATTTAAACATGTTTTACCTGCAGAAATTCTCTCACAAATAACCTGCAATAACTTGAAATGCATACCCTTTTGAACACTTCCTTTTCTCATGTATAAATTAAAATGTTTGCTGCATTTTGCAAAATGTCAATTCTCTAAAAATGTGTCCGTATATTTCTGTACCTGCAGTGTAGTAAAGGTTTAGACGAAACCCCATAATTATAGTGGCATACTGTCACTTAGGTTTCAAGCAGCAAAATAAACAGTGCAGCTCAGAAATTGTAGTTTGGTTCTTGATGTGTTTTTATTACATTTGGAGTTGTTTTGTTTTTTAGTACCTTCGAAATTTCAAATTATTTTATCTTCAGTTAATGATTTTAAAAAGCCTGGGGGCAAATAAGTTGGTTATTTGCTTTCAAGTTTTTAAAAGTAGTCTTTATTGATAGAGTAAGGAGAACTACTTTCTAACAAAACACGTGCATAGTTATGACAGTGATGCTTTAAAGGAATAAAATTCTTTTTTTTTAAAGAGTGATATTCCTTTTCAAAAGAATACTAACTCTCAGAATGTTCACTTTAAACGAATATGCCAGAACATAGACAGCTAAATGAATGTTACTCTGCATAGTGATCATGCTGGAAGGTTATTTCCTAATGCCAGCAATCTACCATTGCCCAAAACCTGCTGAGTTTACTCTTTTAGAATTGCATTCAAAGTTAATTTGTCACACACACTAAACTTTATGATTATACATTGTTTTAAAAAATATAGTATTAGGAAGCTTGATTATTTTTAGTTACCATTACTTGGCACCAAATGAAAGTTTCCAAAACTTCCACCTAACTTTGAGGTAATGCAGAAAGTATATAACTGGCTTTGAAGGCAATCCCAAAAGAGTTTTAAAGGTTTTTTGAGCAGTGGCAGTATACTTAGGAGAATGAACTGTGGCCTTCCAAGGTAACTACCTTAAAGGAACTCAGCTCATTTGAATGTATTGAGTTTTGGATGTATTTGTTTCATTTTTTAAAAAGTTCACATTATTTTATAGTGTCGAAAGGAAGAACTAGGATTAACATAATTTCTTTGGTTTTTCTATTGCTTGTTATTATTATGTAAAAACTGGGTGGCAGTTCAGAAGGAAGATTGTGGTTACAGAAGAGTGACAACCAAGAATTTTTTGATCATTAAATCAGATTTTATAAACAGTGGAAGGAGCATGGACTTAAAACAAGGCATGCTTATTCGGTTTTGTCAAAATTTTACGAAAATATGTGATATATATTTATACTAAAAATATATAATCCTTAGATTTAGAAAAGCAATCAGTTAATGTCTTTAGCAGACTAAAGCAGTATTAAACACAGGTACAAGTTGGAAATTGTAGAAAACGGAAAGAAAACAAAAGACAAAATGTCTATGGTAGGGAATAAAAGTTTAAGATATTATAAAATTATGTGTATTTTCTCTTTTACATAAATCATTTGTGAAAAGTGTGCTAAACTTTTTTTACAAGAGTGATATTAATTAGGATTTATTTTTCAATATAATTTGGAGACCCTTTGTTATCCAAATAAAAATGATGAGTTTTTGTGCCTGTA