Transcript asmbl_128208

Sequence
Transcript Sequence for observation asmbl_128208 of TGE0000476:
CGCCTCTGAGCCGCGGAGGATTGTGGGAGGAGGTTGTCTCCAATTTCTCCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTACGACCTGGAATACTCTGAAGATAGTAACTCCGAGCCAAATGTGGATTTGGAAAATCAGTACTATAATTCCAAAGCATTAAAAGAAGATGACCCAAAAGCGGCATTAAGCAGTTTCCAAAAGGTTTTGGAACTTGAAGGTGAAAAAGGAGAATGGGGATTTAAAGCACTGAAACAAATGATTAAGATTAACTTCAAGTTGACAAACTTTCCAGAAATGATGAATAGATATAAGCAGCTATTGACCTATATTCGGAGTGCAGTCACAAGAAATTATTCTGAAAAATCCATTAATTCTATTCTTGATTATATCTCTACTTCTAAACAGAATTCTGATTTTTTATGTCAGATGGATTTACTGCAGGAATTCTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGTGGTTTAAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAGGAATATGGAAAGCTTCAAAAAATTTTACGCCAGTTACATCAGTCGTGCCAGACTGATGATGGAGAAGATGATCTGAAAAAAGGTACACAGTTATTAGAAATATATGCTTTGGAAATTCAAATGTACACAGCACAGAAAAATAACAAAAAACTTAAAGCACTCTATGAACAGTCACTTCACATCAAGTCTGCCATCCCTCATCCACTGATTATGGGAGTTATCAGAGAATGTGGTGGTAAAATGCACTTGAGGGAAGGTGAATTTGAAAAGGCACACACTGATTTTTTTGAAGCCTTCAAGAATTATGATGAATCTGGAAGTCCAAGACGAACCACTTGCTTAAAATATTTGGTCTTAGCAAATATGCTTATGAAATCGGGAATAAATCCATTTGACTCACAGGAGGCCAAGCCGTACAAAAATGATCCAGAAATTTTAGCAATGACGAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTAAAAACAAATCACAGCAACATCATGGATGATCCTTTCATAAGAGAACACATTGAAGAGCTTTTGCGAAACATCAGAACACAAGTGCTTATAAAATTAATTAAGCCTTACACAAGAATACATATTCCTTTTATTTCTAAGGAGTTAAACATAGATGTAGCTGATGTGGAGAGCTTGCTGGTGCAGTGCATATTGGATAACACTATTCATGGCCGAATTGATCAAGTCAACCAACTCCTTGAACTGGATCATCAGAAGAGGGGTGGTGCACGATATACTGCACTAGATAAATGGACCAACCAACTAAATTCTCTCAACCAGGCTGTAGTCAGTAAACTGGCTTAACAGAGAACAAGCTTTTACAGACGTCCTTAAGGCAACAGTGCAGAGATGTAATCCTTAAAAGAACTGGGAATGGCAAAACTACTGTCGGTTGATGTGTCCTGAAAATTATTGGAGTTATGGCAGAAGTGCTTTTTTGATCAACTGGTTTGTGTTTTGCTGCTGCATTTATCCCAAGAAAAACAGCTTTAATCTCCAGAAGAAAACCAAAATACCATGGGATTTATGCTGTATTGACATCTTGCCCTAAACGTACAACATCATAGTAATTTGTCATGGGCAACATGACCAGAGAGAAGATTTTTGTCATGATTTTAAATACACTGACACGCTACTGTTGGTTAAATTTAAACATGTTTTACCTGCAGAAATTCTCTCACAAATAACCTGCAATAACTTGAAATGCATACCCTTTTGAACACTTCCTTTTCTCATGTATAAATTAAAATGTTTGCTGCATTTTGCAAAATGTCAATTCTCTAAAAATGTGTCCGTATATTTCTGTACCTGCAGTGTAGTAAAGGTTTAGACGAAACCCCATAATTATAGTGGCATACTGTCACTTAGGTTTCAAGCAGCAAAATAAACAGTGCAGCTCAGAAATTGTAGTTTGGTTCTTGATGTGTTTTTATTACATTTGGAGTTGTTTTGTTTTTTAGTACCTTCGAAATTTCAAATTATTTTATCTTCAGTTAATGATTTTAAAAAGCCTGGGGGCAAATAAGTTGGTTATTTGCTTTCAAGTTTTTAAAAGTAGTCTTTATTGATAGAGTAAGGAGAACTACTTTCTAACAAAACACGTGCATAGTTATGACAGTGATGCTTTAAAGGAATAAAATTCTTTTTTTTTAAAGAGTGATATTCCTTTTCAAAAGAATACTAACTCTCAGAATGTTCACTTTAAACGAATATGCCAGAACATAGACAGCTAAATGAATGTTACTCTGCATAGTGATCATGCTGGAAGGTTATTTCCTAATGCCAGCAATCTACCATTGCCCAAAACCTGCTGAGTTTACTCTTTTAGAATTGCATTCAAAGTTAATTTGTCACACACACTAAACTTTATGATTATACATTGTTTTAAAAAATATAGTATTAGGAAGCTTGATTATTTTTAGTTACCATTACTTGGCACCAAATGAAAGTTTCCAAAACTTCCACCTAACTTTGAGGTAATGCAGAAAGTATATAACTGGCTTTGAAGGCAATCCCAAAAGAGTTTTAAAGGTTTTTTGAGCAGTGGCAGTATACTTAGGAGAATGAACTGTGGCCTTCCAAGGTAACTACCTTAAAGGAACTCAGCTCATTTGAATGTATTGAGTTTTGGATGTATTTGTTTCATTTTTTAAAAAGTTCACATTATTTTATAGTGTCGAAAGGAAGAACTAGGATTAACATAATTTCTTTGGTTTTTCTATTGCTTGTTATTATTATGTAAAAACTGGGTGGCAGTTCAGAAGGAAGATTGTGGTTACAGAAGAGTGACAACCAAGAATTTTTTGATCATTAAATCAGATTTTATAAACAGTGGAAGGAGCATGGACTTAAAACAAGGCATGCTTATTCGGTTTTGTCAAAATTTTACGAAAATATGTGATATATATTTATACTAAAAATATATAATCCTTAGATTTAGAAAAGCAATCAGTTAATGTCTTTAGCAGACTAAAGCAGTATTAAACACAGGTACAAGTTGGAAATTGTAGAAAACGGAAAGAAAACAAAAGACAAAATGTCTATGGTAGGGAATAAAAGTTTAAGATATTATAAAATTATGTGTATTTTCTCTTTTACATAAATCATTTGTGAAAAGTGTGCTAAACTTTTTTTACAAGAGTGATATTAATTAGGATTTATTTTTCAATATAATTTGGAGACCCTTTGTTATCCAAATAAAAATGATGAGTTTTTGTGCCTGTA