Transcript asmbl_127875

Sequence
Transcript Sequence for observation asmbl_127875 of TGE0000470:
AGGCTCGGGGAGGTAAGCGGCGGCAGGCCGGCGGTTGGTGTGTCCCGGGTGTGGGGAGGCGACAGAGCCCTGGCACTTGAGGGTTGAGGGGGCCTCCCCAGCGCGGCGAACCGTCTAGCCTCCGGAGGCCAGGCCGTGAGTGCGGGAGGTATACGCCAAGGCGGAAGAATTTTGCCACTCACTACCTGTGTGACCTCGGGTAAATTAGCCTTGGAACGTCAGTTTCTTCGTCTCTATAATTGAAATAATAATAGTACCTCTCTCAGGATTGTTGTGAGCCGTCAGTGAAACACTTAGAGCAGTTTCTGGCACATGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGCCAAGGTTGTCTGGCAATTCCGGGGGAAAGAAGATTTGGATAAGTGGACAGTGACTTCTGATAAGACGATTGGAGGCAGAAGTGAAGTGTTTTTGAAAATGGGCAAGAATAACCAAAGTGCACTGCTATATGGAACTCTGAGCTCTGAGGCGCCTCAGGACGGGGAGTCTACCCGAAGTGGGTACTGTGCAATGATATCCAGGATTCCAAGGGGTGCTTTTGAGAGGAAGATGTCTTACGATTGGTCCCAGTTCAATACTCTGTATCTCCGTGTACGTGGGGATGGTCGGCCTTGGATGGTGAATATCAAGGAGGACACAGATTTCTTCCAGAGGACGAATCAGATGTATAGTTACTTCATGTTCACCCGCGGGGGACCCTACTGGCAGGAGGTCAAGATTCCTTTTTCCAAATTTTTCTTCTCTAATCGAGGAAGAATCCGGGATGTTCAGCATGAGCTTCCGCTTGATAAGATCTCTTCTATAGGATTCACCTTGGCTGATAAAGTGGATGGTCCATTCTTCCTGGAGATAGATTTTATTGGCGTGTTTACTGATCCAGCTCATACAGAAGAATTTGCCTATGAAAATTCTCCAGAGCTTAACCCAAGGCTTTTTAAATAAAGATCATATGGTAGTTTTGTTTTACTAATCTAAGGGTACTAGCATCTACAATGATATAGACAAAATAAAATATTTCTTTAATGGCAT