Transcript asmbl_126839

Sequence
Transcript Sequence for observation asmbl_126839 of TGE0000458:
CGGCGTTTCCACGGACGCCCAGGAGACAGCCGGTTGCTGAGCCGGGAGCGCTGACTGGCCCGGCTGGGCAGGTCTTGACTCGTCTGCTGAACAAATCCTCTGACCTCAGGCCGGCTGTGAACGTAGTTCCTGAGAGATAGCAAACATGCCCAACAGTGAGCCCGCATCTCTGCTGGAGCTGTTCAACAGCATCGCCACACAAGGGGAGCTCGTAAGGTCCCTCAAAGCGGGAAATGCGTCAAAGGATGAAATTGATTCTGCAGTAAAGATGTTGGTGTCATTAAAAATGAGCTACAAAGCTGCCGCGGGGGAGGATTACAAGGCTGACTGTCCTCCAGGGAACCCAGCACCTACCAGTAATCATGGCCCAGATGCCACAGAAGCTGAAGAGGATTTTGTGGACCCATGGACAGTACAGACAAGCAGTGCAAAAGGCATAGACTACGATAAGCTCATTGTTCGGTTTGGAAGTAGTAAAATTGACAAAGAGCTAATAAACCGAATAGAGAGAGCCACCGGCCAAAGACCACACCACTTCCTGCGCAGAGGCATCTTCTTCTCACACAGAGATATGAATCAGGTTCTTGATGCCTATGAAAATAAGAAGCCATTTTATCTGTACACGGGCCGGGGCCCCTCTTCTGAAGCAATGCATGTAGGTCACCTCATTCCATTTATTTTCACAAAGTGGCTCCAGGATGTATTTAACGTGCCCTTGGTCATCCAGATGACGGATGACGAGAAGTATCTGTGGAAGGACCTGACCCTGGACCAGGCCTATAGCTATGCTGTGGAGAATGCCAAGGACATCATCGCCTGTGGCTTTGACATCAACAAGACTTTCATATTCTCTGACCTGGACTACATGGGGATGAGCTCAGGTTTCTACAAAAATGTGGTGAAGATTCAAAAGCATGTTACCTTCAACCAAGTGAAAGGCATTTTCGGCTTCACTGACAGCGACTGCATTGGGAAGATCAGTTTTCCTGCCATCCAGGCTGCTCCCTCCTTCAGCAACTCATTCCCACAGATCTTCCGAGACAGGACGGATATCCAGTGCCTTATCCCATGTGCCATTGACCAGGATCCTTACTTTAGAATGACAAGGGACGTCGCCCCCAGGATCGGCTATCCTAAACCAGCCCTGCTGCACTCCACCTTCTTCCCAGCCCTGCAGGGCGCCCAGACCAAAATGAGTGCCAGCGACCCCAACTCCTCCATCTTCCTCACCGACACGGCCAAGCAGATCAAAACCAAGGTCAATAAGCATGCGTTTTCTGGAGGGAGAGACACCATCGAGGAGCACAGGCAGTTTGGGGGCAACTGTGATGTGGACGTGTCTTTCATGTACCTGACCTTCTTCCTCGAGGACGACGACAAGCTCGAGCAGATCAGGAAGGATTACACCAGCGGAGCCATGCTCACCGGTGAGCTCAAGAAGGCACTCATAGAGGTTCTGCAGCCCTTGATCGCAGAGCACCAGGCCCGGCGCAAGGAGGTCACGGATGAGATAGTGAAAGAGTTCATGACTCCCCGGAAGCTGTCCTTCGACTTTCAGTAGCACTCGTTTTACATATGCTTATAAAAGAAGTGATGTATCAGTAATGTATCAATAATCCCAGCCCAGTCAAAGCACCGCCACCTGTAGGCTTCTGTCTCATGGTAATTACTGGGCCTGGCCTCTGTAAGCCTGTGTATGTTATCAATACTGTTTCTTCCTGTGAGTTCCATTATTTCTATCTCTTATGGGCAAAGCATTGTGGGTAATTGGTGCTGGCTAACATTGCATGGTCGGATAGAGAAGTCCAGCTGTGAGTCTCTCCCCAAAGCAGCCCCACAGTGGAGCCTTTGGCTGGAAGTCCATGGGCCACCCTGTTCTTGTCCATGGAGGACTCCGAGGGTTCCAAGTATACTCTTAAGACCCACTCTGTTTAAAAATATATATTCTATGTATGCGTATATGGAATTGAAATGTCATTATTGTAACCTAGAAAGTGCTTTGAAATATTGATGTGGGGAGGTTTATTGAGCACAAGATGTATTTCAGCCCATGCCCCCTCCCAAAAAGAAATTGATAAGTAAAAGCTTCGTTATACATTTGACTAAGAAATCACCCAGCTTTAAAGCTGCTTTTAACAATGAAGATTGAACAGAGTTCAGCAATTTTGATTAAATTAAGACTTGGGGGTGAAACTTTCCAGTTTACTGAACTCCAGACCATGCATGTAGTCCACTCCAGAAATCATGCTCGCTTCCCTTGGCACACCAGTGTTCTCCTGCCAAATGACCCTAGACCCTCTGTCCTGCAGAGTCAGGGTGGCTTTTCCCCTGACTGTGTCCGATGCCAAGGAGTCCTGGCCTCCGCAGATGCTTCATTTTGACCCTTGGCTGCAGTGGAAGTCAGCACAGAGCAGTGCCCTGGCTGTGTCCCTGGACGGGTGGACTTAGCTAGGGAGAAAGTCGAGGCAGCAGCCCTCGAGGCCCTCACAGATGTCTAGGCAGGCCTCATTTCATCACGCAGCATGTGCAGGCCTGGAAGAGCAAAGCCAAATCTCAGGGAAGTCCTTGGTTGATGTATCTGGGTCTCCTCTGGAGCACTCTGCCCTCCTGTCACCCAGTAGAGTAAATAAACTTCCTTGGCTCCTG