Transcript asmbl_126428

Sequence
Transcript Sequence for observation asmbl_126428 of TGE0056213:
CGAGGCCTGGCAGCTGTAGTGCTTCTGGGCAGTAGAGGCGCGGGGTGCGGAGCTAGGGCGGCCGAGAGCCATGGCGGCGCTATTGGCGGCGGCGGCAGTGCGAGCCCGGATCCTGCAGGTTTCTTCCAAGGTGAAATCCAGTCCCACCTGGTATTCAGCATCTTCCTTCTCTTCTTCAGTGCCAACTGTAAAGCTCTTCATTGGTGGGAAATTCGTTGAATCCAAAAGTGACAAATGGATCGATATCCACAACCCAGCCACCAATGAGGTCATTGGTCGGGTCCCTCAGGCCACCAAGGCAGAAATGGATGCAGCCATTGCTTCCTGCAAACGTGCTTTTCCTGCATGGGCAGACACTTCAGTATTAAGCCGCCAGCAGGTCTTGCTCCGCTATCAACAACTTATTAAAGAAAACTTGAAAGAAATTGCCAAGTTAATCACATTGGAACAAGGGAAGACCCTAGCTGATGCTGAAGGAGATGTATTTCGAGGCCTTCAGGTGGTTGAGCATGCCTGTAGTGTGACATCCCTCATGATGGGAGAGACCATGCCATCCATCACCAAAGACATGGACCTTTATTCCTACCGTCTGCCTCTGGGAGTGTGTGCAGGCATTGCTCCATTCAATTTTCCTGCCATGATCCCCCTTTGGATGTTTCCCATGGCCATGGTGTGTGGAAATACCTTCCTAATGAAACCATCTGAGCGAGTCCCTGGAGCAACTATGCTTCTTGCTAAGTTGCTCCAGGATTCTGGTGCCCCTGATGGAACATTAAACATCATCCATGGACAGCATGAAGCTGTAAATTTTATTTGCGATCATCCGGACATCAAAGCAATCAGCTTTGTGGGATCCAACAAGGCAGGAGAGTATATCTTCGAGAGAGGATCAAGACATGGCAAGAGGGTTCAAGCCAATATGGGAGCCAAGAACCATGGGGTAGTCATGCCAGATGCCAATAAGGAAAATACCCTGAACCAGCTGGTTGGGGCAGCATTTGGAGCTGCTGGTCAGCGCTGCATGGCTCTTTCAACAGCAGTCCTTGTGGGAGAAGCCAAGAAGTGGCTGCCAGAGCTGGTGGAGCATGCCAAAAACCTGAGAGTCAATGCAGGAGATCAGCCTGGAGCTGATCTTGGCCCTCTGATCACTCCCCAGGCCAAAGAGCGAGTCTGTAATCTGATTGATAGTGGAACAAAGGAGGGAGCTTCCATCCTTCTTGATGGACGAAAAATTAAAGTGAAAGGCTATGAAAATGGCAACTTTGTTGGACCAACCATCATCTCGAATGTCAAGCCAAATATGACCTGTTACAAAGAGGAGATTTTTGGTCCAGTTCTTGTGGTTCTGGAGACAGAAACATTGGATGAAGCCATCCAGATTGTAAATAACAACCCATATGGAAATGGAACTGCCATCTTCACCACCAATGGAGCCACTGCTCGGAAATATGCCCACTTGGTGGATGTTGGACAGGTGGGAGTGAATGTCCCCATTCCAGTGCCTTTGCCAATGTTCTCATTCACCGGCTCTCGATCCTCCTTCAGGGGAGACACCAATTTCTATGGCAAACAGGGCATCCAATTCTACACTCAGTTAAAGACCATTACTTCTCAGTGGAAAGAAGAAGATGCTACTCTTTCCTCACCTGCTGTTGTCATGCCTACCATGGGCCGTTAGAAACAAGTTTGTTTAAGACTGACTCCATCCTGAGTAATCTCCCTTTATTTTTGACCAGCTTCATTTGTCAGCTTTGCTCAGATCAGATCGATGGGATTGGAATACATTGTAACTAAAATCTTCCTCAGGACTATTAACCCCCGCAAAGTTTCTATAGGGAACTGCCTAGTGTAACAATGAAACCAGATTTCTCACTTGCTCTTCATACTTCTATTTTGAGGTAACTGTTGTAACTATGAAATGCTTATCTGAAAGTAGTGCTTAAACCTGATTTCTAAAAATTATCCCATTTTCTGATGATTTGAAGGGGAGAAAAGCCAGTGTATGTAAAGAAAATGTTCCAGCCAGGCGCGGTGGCTCACGCCTGTAAT