Transcript asmbl_126046

Sequence
Transcript Sequence for observation asmbl_126046 of TGE0000435:
CAGGGAGTGGGATACGCTGTGGCTTTAGGGAGCTGGGAAAGGCGCTCTCTCCCGGTCCCGCTCTGCCCGGTCCCACGCCCCTCGGCCGTCCGGCTGCCTGGGTCTTCCGGGTTCTTCCGCCCCTCTGGCTCGGTCCCCGCTACCTCTCCTCCCTCCTCCCCTCTCGGTACCTTCGCCCGCCGCGCGCCTTTCTCAAATCCTCCGGTTATTAAGCAAGCTCAGGGGTCCGGTGGCCTGCCCTGGTAACTCTGCGCCCGCCCCTTCCTGCCCCCTTCCTGCCCTCACGCCCCGTCCCCTCCTCTTGACGTGGCAGAGGCGGCGCCAGCCATGTTGGCCGGGCGGAGGTCTTCGCTGAGGCCCGGGGCGGGGTGGCGCCACCCCTGATTGCGGTGCCACGGACTGCTCCTGCTGGGCGGAGAGGACAGATTTTGCAAAGCGGAGGCTGCGACGGGTCCTGCAGGGGGACAGTGAGGAAAGGGCCGCCTCGTCTCCGCTCCTGGGGGACCGCAGAAATAAGAATCAAACTCCACAATGACAACCTATTTGGAATTCATTCAACAAAATGAAGAACGAGATGGAGTCCGATTTAGTTGGAATGTTTGGCCATCAAGTCGACTGGAAGCTACAAGAATGGTTGTTCCTGTGGCAGCCCTGTTTACACCACTGAAAGAGAGACCTGACTTACCACCTATTCAATATGAACCTGTTCTGTGTAGTAGGACCACTTGCCGTGCAGTTTTGAATCCTTTATGTCAAGTGGATTATCGAGCAAAACTTTGGGCTTGCAACTTTTGTTACCAAAGGAATCAGTTTCCACCTAGTTATGCTGGTATATCTGAACTGAATCAGCCTGCTGAACTTTTACCTCAGTTTTCTAGCATTGAATATGTAGTTCTGCGTGGTCCTCAGATGCCTTTGATATTCCTCTATGTGGTTGATACTTGCATGGAAGATGAAGATTTACAAGCCCTGAAAGAATCCATGCAGATGTCATTAAGTCTTTTACCACCTACAGCTTTGGTTGGACTTATTACTTTTGGGAGAATGGTTCAGGTTCATGAACTTGGATGTGAAGGCATTTCAAAAAGCTATGTCTTCAGAGGAACAAAAGATTTGTCTGCCAAACAACTGCAGGAAATGCTGGGGCTCTCTAAAGTACCACTTACTCAAGCAACACGTGGTCCTCAGGTACAGCAGCCACCTCCTTCCAACAGATTCTTACAACCAGTACAGAAAATAGACATGAATCTCACAGATCTTCTGGGAGAACTCCAGCGAGACCCTTGGCCTGTACCACAGGGAAAGAGACCTTTGCGTTCCTCTGGGGTGGCACTTTCCATAGCTGTAGGACTGCTGGAGTGTACTTTTCCCAACACTGGTGCTCGTATCATGATGTTCATTGGTGGTCCTGCTACTCAGGGGCCTGGAATGGTGGTTGGAGATGAGTTGAAGACACCTATAAGATCGTGGCATGACATTGACAAAGACAATGCCAAATATGTTAAAAAGGGAACTAAGCATTTTGAAGCATTGGCTAATCGAGCTGCTACAACTGGCCATGTTATTGATATCTATGCGTGTGCATTAGATCAGACAGGTCTCCTGGAGATGAAATGCTGTCCCAACCTTACTGGAGGATACATGGTAATGGGTGATTCTTTCAATACTTCCTTATTCAAACAAACTTTTCAAAGAGTCTTTACCAAAGACATGCATGGACAGTTTAAAATGGGCTTTGGTGGTACGCTAGAAATAAAGACCTCAAGGGAAATAAAGATTTCAGGAGCTATTGGACCCTGTGTGTCACTCAATTCTAAAGGACCCTGTGTGTCTGAAAATGAGATAGGAACAGGTGGCACATGTCAGTGGAAGATATGTGGACTTAGTCCCACTACAACCTTAGCCATATATTTTGAGGTTGTCAATCAGCATAATGCTCCAATTCCTCAAGGAGGGCGTGGTGCAATCCAGTTTGTGACTCAGTATCAGCATTCAAGTGGGCAGAGACGCATCCGAGTGACCACCATTGCTAGGAACTGGGCAGATGCTCAAACTCAAATCCAAAACATTGCTGCATCTTTTGACCAGGAGGCAGCTGCCATTCTTATGGCCCGGCTAGCAATATATAGAGCAGAAACAGAAGAAGGTCCAGATGTGCTTAGGTGGCTGGACAGACAGCTCATTCGACTGTGTCAGAAATTTGGAGAATATCATAAAGATGACCCAAGTTCCTTCAGATTTTCAGAAACTTTCTCCCTTTATCCACAGTTTATGTTTCATTTAAGAAGATCTTCTTTCCTGCAAGTTTTTAACAATAGTCCTGATGAGAGTTCATATTATCGTCACCATTTTATGCGTCAAGATCTGACCCAGTCTCTAATTATGATTCAGCCTATCCTGTATGCGTATTCTTTTAGTGGACCACCAGAGCCGGTTCTTCTTGATAGCAGTAGCATTCTTGCAGATCGTATTCTTCTCATGGACACATTCTTCCAGATTTTGATTTATCATGGTGAGACCATAGCACAGTGGCGGAAGTCAGGATACCAGGATATGCCTGAGTATGAAAATTTCCGCCACCTTCTGCAAGCCCCAGTGGATGATGCACAGGAAATTCTTCACTCCAGATTTCCAATGCCAAGATACATTGACACTGAACATGGAGGCAGCCAGGCCCGTTTCCTCCTTTCAAAAGTCAACCCTTCACAGACTCATAATAATATGTATGCCTGGGGGCAGGAGTCTGGAGCACCTATTCTTACAGATGATGTTAGTTTACAAGTGTTTATGGATCACTTGAAGAAACTTGCTGTGTCCAGTGCTGCTTGAAGTGCTAATAATGTTAAAGACACTTAAGAAGATGAAATAATATTCAAATTTCATTTTTTCCTTTTTCCATTTATCTGTGGAAACCAACAGATATTGCTCTATATTTTTTGTATTAGTATGGTTTGAGACAACATATGGAAAATGTTCACATTTGTAGATTAAGCTGGAATTATAATGAGAGCAATAAGAACAAATTTATTTTGCTTACCACAGTGTTATAGCTGGTTCTAGAAATTTGAAGTCTTTATAACTTAATTATGTTTAATAAAAAATAGAGTCTGCCTCGTACTACAGATGTAACTCATTTGTATATTGCAGACAGACCCAAAGTGGCACTGAATTTTCTTGCTCACCTTTTAAAAACTTGTTCCTTAATTTTAGCCAGAAAGCAAAAAAACAATAGTAATGATAAATGTGAACATTTTTGCTTATTCATTGAATATTTTTCTGTAATTTTCAGCACTTATGTATACACTTTTTCTGTACTTACTAGGTTAAGGCAGATTTATTTTTATGATTTGTTTAGGAATTATTTGATTTTATAATGGTAATTTTCATGATGATAATGTTTTTGGTTATTTGGAAAGATAGTTTAGAGATGAAAGGTTTTTTTGGGTAACAATCCCGCAGCTGACAAAAAATGTGAAATTTCCACAAAATATCCAACTTATGTGACTAAACGCAGTAGTTTTTTTAAAAGGGGAGATAGAAAATAAATGGTTTTGTTGGAGTGCATTTTAGTAAGCCTTTGCAGTAAAATGACGGTTGTAACTACTAAACCAAATTTAGTTTTCACAGCATGGTTTTGTTGTTTTCCCCTTGTTTTTCAGAGGTAAATTTTGCATTATATCCTTCAGTATTTTAACACTATTTTGGCAGTTTACACATTACTTTTTGTTTTTCCTTCCTTTTTGTGAAATGTATTAAGTTGTGGTTCTTATTGAAACAGTATTATATAATGTTTGCTTAATTATATCATGTGATGCTCAGTTCTATTTTGATTTATTCATTAGTATTCACTTTTACCTTTAAAGTTTACTTGTAGCAAATATGTTTACATTGATAAAGCCAGATATGTTTTGACAATGAAATTTACATATCAAGTACTGCAAATAAAAGGTGGTGCTATGATATATGCTTAGGAGGACAGTTTTAATGATTGTACTTGCATGAACACAATCATATGATGGTAAAGCAGAAACTTAAGAAAAAATTGTTTATGTGTTATATTCAATTAGCTTAAATAAGTTGCTTTGTTATATTTTATTTGAATTGAACTACGCTAGGCCTAAATGCCAATAAAATATACTTTTCACTGTT