Transcript asmbl_125489

Sequence
Transcript Sequence for observation asmbl_125489 of TGE0000427:
CTGGAGTGGGAGGACTCACCGCTAAGGGTTCAGAACCGATTTTCAACCAGTCACGCCCTTCTCAAAGATGGCCGACCTCACTTCCCTTACGCAACATGGACGTTTTCAGTCACTTCCTGTGATTTTGAGGTTATTCTGATCCAGGACTACTTGCATGACCAAAGCCAAGATGGCAGGTACGTCCTTTTAGAATTTAAGGTTAGTGAAGCCATCTATTTCCCCGACCCCCTTCAGTGAAAATGGTCTTTCGCATCTGGCTCTTCTTTTTGGAGGCGTGCTTGCCAGCAGTCAAAATGGCTCCATTCCGGAATAGATTTAATAGGAAGTGAAGCTGTGACGGCGAGGCGTTGCCCGGCCTATCTTTGCTAGGCGTTCTCAGAATTAGTTCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCTGGATCTAGGTCCAGGGAGTCTCAGTGATGGTCTGAGCCTGGCCGCGCCAGGCTGGGGTGTCCCAGAAGAGCCAGGAATCGAAATGCTTCATGGAACAACCACCCTGGCCTTCAAGTTCCGCCATGGAGTCATAGTTGCAGCTGACTCCAGGGCTACAGCGGGTGCTTACATTGCCTCCCAGACGGTGAAGAAGGTGATAGAGATCAACCCATACCTGCTAGGCACCATGGCTGGGGGCGCAGCGGATTGCAGCTTCTGGGAACGGCTGTTGGCTCGGCAATGTCGAATCTATGAGCTTCGAAATAAGGAACGCATCTCTGTAGCAGCTGCCTCCAAACTGCTTGCCAACATGGTGTATCAGTACAAAGGCATGGGGCTGTCCATGGGCACCATGATCTGTGGCTGGGATAAGAGAGGCCCTGGCCTCTACTACGTGGACAGTGAAGGGAACCGGATTTCAGGGGCCACCTTCTCTGTAGGTTCTGGCTCTGTGTATGCATATGGGGTCATGGATCGGGGCTATTCCTATGACCTGGAAGTGGAGCAGGCCTATGATCTGGCCCGTCGAGCCATCTACCAAGCCACCTACAGAGATGCCTACTCAGGAGGTGCAGTCAACCTCTACCACGTGCGGGAGGATGGCTGGATCCGAGTCTCCAGTGACAATGTGGCTGATCTACATGAGAAGTATAGTGGCTCTACCCCCTGAAAGAGGGTGGATGCAGCTGCTTGTGTTTCTTGGGGTGACTGTCATTGGTAATACGGACACAGTGACCCATCCTCCATCCTATTTATAGTGGAAGGGCCTTCAATTGTATCAGTACTTTTTTTTAAGCTCTGGCACATTGACCTCTATGTGTTACCAGTCATTAATGAGCTGCTGCAGAGGTGACTATTTGTTTTACTTTCTTGGATGTTAACATTACACTACTCACTACTC