Transcript asmbl_125434

Sequence
Transcript Sequence for observation asmbl_125434 of TGE0061002:
AAACAAACAAACAAAAAAAAAACCTAACGCTGTTGGGACCCGGAAGCGGAAAGGGCATCTTTGAGGTCGATACTTCCGGGTCATTGGGAGAGTGCGGGATTCCTGGGCCGAGAGCGGGTGGCTGAGCCGGGACCTCGCGTGATTCTCGGAACCCGAGGAGAAGCGGCGTCCGGGGCTATGGCTGTGACTCTGGACAAAGACGCTTATTATCGGCGAGTGAAGAGACTGTACAGCAATTGGCGGAAAGGAGAAGATGAGTATGCCAACGTTGATGCCATTGTTGTATCAGTGGGTGTTGATGAAGAAATTGTTTATGCCAAATCAACTGCCTTACAGACATGGCTCTTTGGTTATGAACTAACTGATACTATCATGGTCTTTTGTGATGACAAAATCATCTTTATGGCCAGCAAGAAAAAAGTGGAGTTCTTGAAACAGATTGCCAACACTAAGGGCAATGAGAATGCTAATGGAGCCCCTGCCATCACACTGCTAATACGAGAAAAGAATGAAAGTAATAAGAGTAGCTTTGACAAAATGATTGAAGCCATTAAAGAAAGCAAGAATGGCAAGAAGATTGGAGTGTTCAGCAAAGACAAATTCCCTGGAGAGTTCATGAAGAGCTGGAATGACTGCCTCAACAAAGAAGGCTTTGACAAAATAGATATCAGTGCAGTTGTGGCATATACCATCGCTGTAAAGGAGGATGGGGAGCTCAACCTAATGAAGAAAGCAGCCAGCATCACTTCTGAAGTCTTCAACAAATTCTTCAAGGAAAGAGTCATGGAAATAGTTGATGCAGATGAGAAAGTTCGACACAGCAAACTGGCTGAGTCTGTGGAAAAGGCCATTGAAGAGAAAAAATACCTTGCTGGGGCAGACCCTTCTACTGTGGAAATGTGTTACCCTCCTATCATTCAGAGTGGTGGCAACTATAATCTCAAGTTCAGTGTGGTGAGTGACAAGAATCATATGCACTTTGGGGCTATCACTTGTGCCATGGGTATTCGCTTCAAGTCTTACTGCTCCAACCTTGTTCGCACTTTGATGGTTGATCCTTCTCAAGAAGTTCAAGAAAATTATAACTTTTTGCTCCAGCTTCAAGAGGAGCTGCTGAAGGAATTAAGACATGGTGTGAAGATATGTGACGTGTATAACGCTGTCATGGACGTGGTTAAAAAGCAGAAGCCAGAACTGCTGAACAAAATTACCAAAAACCTAGGGTTTGGGATGGGAATTGAATTCCGTGAAGGCTCCCTAGTAATCAATAGCAAAAATCAATACAAACTGAAGAAAGGAATGGTTTTCAGCATCAATTTAGGATTCTCAGACCTGACTAACAAGGAGGGGAAAAAGCCAGAAGAGAAAACCTATGCCCTGTTCATTGGTGACACAGTGCTTGTGGATGAGGATGGCCCAGCTACTGTTCTCACTTCTGTGAAGAAGAAAGTGAAGAATGTGGGGATTTTCCTAAAGAATGAAGATGAGGAAGAAGAGGAGGAGGAGAAAGATGAGGCAGAGGACCTTTTGGGAAGAGGTTCTCGGGCAGCATTACTTACAGAAAGAACAAGAAATGAAATGACTGCAGAAGAGAAGCGAAGAGCACATCAGAAAGAACTAGCGGCTCAACTCAATGAAGAAGCAAAGAGGCGATTGACTGAACAAAAGGGAGAACAGCAGATTCAGAAAGCTCGCAAGTCTAATGTGTCCTATAAAAACCCATCTCTGATGCCTAAGGAACCACATATTCGGGAAATGAAGATCTACATCGATAAGAAATATGAGACTGTAATAATGCCCGTGTTTGGCATTGCAACACCGTTTCACATTGCCACAATCAAGAATATAAGTATGTCCGTGGAAGGAGATTATACTTACTTGCGAATCAACTTTTATTGCCCAGGCAGTGCTCTGGGCAGGAATGAAGGCAACATCTTTCCTAACCCTGAAGCGACTTTTGTCAAGGAAATTACATACCGAGCATCAAATATTAAGGCACCCGGAGAACAGACAGTACCAGCCTTGAACCTTCAGAATGCTTTCCGAATTATTAAAGAAGTACAGAAACGTTATAAAACTCGAGAAGCTGAAGAGAAAGAGAAGGAGGGGATTGTAAAACAAGACTCACTGGTGATCAATCTAAACCGGAGTAATCCGAAACTGAAAGATCTATACATTCGCCCAAATATTGCCCAAAAGAGGATGCAAGGCTCACTGGAGGCCCATGTCAATGGCTTCCGCTTCACATCTGTTCGAGGAGACAAAGTGGATATTTTGTACAATAATATTAAGCATGCTTTGTTCCAGCCCTGTGATGGAGAAATGATTATTGTCTTGCACTTTCACCTCAAGAATGCCATCATGTTTGGGAAGAAGCGGCACACGGATGTGCAGTTCTACACAGAAGTGGGAGAGATAACCACGGACTTGGGGAAACATCAGCATATGCATGACCGAGATGACCTCTATGCTGAGCAGATGGAACGAGAAATGAGGCACAAACTGAAAACAGCCTTTAAAAATTTCATTGAGAAAGTAGAGGCTCTAACTAAGGAGGAACTGGAATTTGAAGTGCCTTTTAGGGACTTGGGATTTAACGGAGCTCCCTATAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCGCTGGTAAATGCTACGGAATGGCCACCTTTTGTGGTGACATTGGATGAGGTAGAGCTGATCCACTTTGAGCGGGTCCAGTTTCACCTGAAGAACTTTGATATGGTAATCGTCTACAAGGACTACAGCAAGAAAGTGACCATGATCAACGCCATTCCTGTAGCCTCTCTTGACCCCATCAAGGAATGGTTGAATTCCTGCGACCTGAAATACACAGAAGGAGTACAGTCCCTCAACTGGACTAAAATCATGAAGACCATTGTTGATGACCCTGAGGGCTTCTTCGAACAAGGTGGCTGGTCTTTCCTGGAGCCTGAGGGTGAGGGGAGTGATGCTGAAGAAGGGGATTCAGAGTCTGAAATTGAAGATGAGACTTTTAATCCTTCAGAAGATGACTATGAAGAGGAAGAGGAGGACAGTGATGAAGATTATTCATCAGAAGCAGAAGAGTCAGACTATTCTAAGGAGTCATTGGGTAGTGAAGAAGAGAGTGGAAAGGATTGGGATGAACTGGAGGAAGAAGCCCGAAAAGCGGACCGAGAAAGTCGTTACGAGGAAGAAGAAGAACAAAGTCGAAGTATGAGCCGGAAGAGGAAGGCATCTGTGCACAGTTCGGGCCGTGGCTCTAACCGTGGTTCCAGACACAGCTCTGCACCCCCCAAGAAAAAGAGGAAGTAACTTCTGAACTTTGGCCCTGAGCTCCATTCTTCCTCCAGCCAACCCCTGAAAATTTTACATGACATAGAAACTGTATTTTTCCTTTCGTTTTCATTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGGCCATTTGTGTGGACCAATCTACTCGGGGAATTCCAGGCCCACCAGGACACGTGCCAATGGCCCCATTCAGATGGCAAGGGAGGAGGTGTTCTTGAAGACAGGAGGAGGCTCCCGCTGTTAATAAATATTGTTTCATTCTTCTCTCTTCCTGTCACCTTCTGCCAAGACATTGATGGCTTCTGACATCTTATTTGGTGTCTCAAAGCTGTATTTCCAAGACAGTGGTACAAGGTGACCCTTAATTACCCGTATCATGGTTCTTGACCAGCACATTCAATCCTCCAACCTACCCTACTGCCATGACCTTCCGCACATCTCTAAGTTTTATCTTTGCAATACTCAAGGTTCTCGGAAATTTGCTAATGGTTGTGATAAACCATACAGCTTGAGCCAGTGAGGCAGATTGGGCTGGTGCCTTCGTCTGAGTTTTCCTGCTTTCCTGCCTCGTGCAGATTCTGAGGTATATCTGCTGCCTTGGAAGACATAAGAAGCAGTGATACTCCCTGGCTCGGTTATTTTCTCCATACAATGCACACATGGTACAATGATAGAAGGCAAAATTGCCACTGTCTTCTTTTTTTTCTCATATATCTAAGGAAGATATATCAGGTTGTGCCTCATGTACCGCTTCTAGTGAAATGTAGAGGAAGGCTCAAAGGAGTCAACATTTATATCTGGAAGGGACAAGTCATGCCTTGGGCCTAGAATACCCTGATGAGAAAAGAGAAGAGGAAGGGAGGCCATATCTACAACACAGCCTCTCGGCACTGCTGCTCCTTATTTTAACTTTGTCTTGCATTGTCCTGTATTTATCACAGTTTCTGTTGAACAGCTTTTCAAGTATTTGGGGAGTTTATCTTGCCATCCTCCCCTTCTGGTTCTCTGCACCCACCTGTCCCACTGCAGTTCCTTCCGTGCTCTGTGACTTTAAGAGAAGAAGGGGGGAGGGGTCCCGGATTTTATGTTTGTTTGTTTTTTCTCCTTAGCAGTAGGACTTGATATTTTCAATTTTGGAAGAACTAAAAGATGAATAAACTGGGTTTTTTTTGTTGTTTGTTTTTGTAAATTCACCTGTGACCGTTCATTTTCAGTTCTTGAAAGCAAGCCTGCTTCCTGCCTGGTAAAGTGCTAAGGTACTGGAGAAAAATGCCTTTAGCTAGCTAGTTTTACAAATGAAACTTTCATCATTCTAAACTTTCATCATTAGATTGAGAGACACTAGACATCACAGTAAACCAAATTCATGTTATAGCAAGCTAACTTTATAAGAGACTTTTTACTATGGTTCCCTCAGAGACTTTTAGATTGGAATAGCACTTGTTCCTTCATGAAAACAAATCTTCAGTCATCTCCTTGTAAATAGCATGGAGGACAGCAGCTGCTTGAAGGGAAACCTTCAGCCTTCCTATTGGGGTAGCCAGATCTTCAGGGCTAACAACTGTTGGGAAAGGGAAAAAAACAGCATCACTCAGTTGAACACTTTGATACTTGGTATTTGTCAGGTTAGGTACTGGGGATGCTAAATGAATGAAATTACCCATTTCATAAGAGGACTCAATCTAGTGAAGGAGAAAGGAAAATGGTATAGTGTATAGGTGCTATATAATAAATGGAAGCACAAGTTGCTTTGGGGACATAACGAGGCATCTGCACCAGAATGGACAAATTGGAAAGGATTTCTGGAGAAATCACCAGAAAAGTCTTAAGTGGATTTTCCCTGTGCACATACAAATGGCATGGAGGTCAGGAAGAACATAGCATGTTTAGGAATGGGGATAGGAGTGAGTTGGAAAATAGCCCACAAAGATAACGTCACTTGCCTTATGCCAGGCACTACCCTAAGCCCCTTAATCCCTTATTTAAGTGCTTCCTTAATCTTCACAACTCAGTAAGATAGAGACTGCTGTTATTCCCGTTTTATAGATGAGGAAAAAGACTAAGGATCACAGTTGGAAAGATACTAGAGGAATATAATTAGAATCTTATCTAACATTTGAACTTTGTAAACCTTAGGGTCTGAGGAGTATTCCTCAAAAAATGTTTATAATGATCAGTAAGAATAATTTTATACCATGATTCATTAAACAATACATAAAACAAGTTTCACAAGACAATAT