Transcript asmbl_125377

Sequence
Transcript Sequence for observation asmbl_125377 of TGE0067326:
GCTTAGCCTCGCCTCCCTCCTCTAATTCTCTAGGACACTTAGGTCCCCAACCCTCCCTCGGGCTGTTTATCGTTGTGCCAGATGCACAGCACATTGTGTGACACTGACTTAAGATTCTAACTATGTGCAAGAGGGAAAAAAACAGTGGAGAAGGCTGGGCTGGACCACGGGAAAGAGATAGGAAAACGGATACGAATGTAAGGCACAGAGTTGGCTCGGCGTCCCTGGCAGTTAGGAAGACAGGTCCCTGGAGGGGCCTTGGCGGGTCTCCGCTCGCGGGAGTTCCGCGGTGTCTTTCCCAGTGCTATCTGCAGGCTGGCCAGCTTCCTCTGCGCTCCGGAAAGCTGCGGCCCAGCGCGGACTAGTGAGGACCTCCACAGCTCCTGACATTGCCAGGAGTCCTGTCGGCGTTTTCTCCCAGCCTCCGCCATGCCGGCGGTGCTGGGTTTTGAAGGCAGCGCCAATAAGATTGGCGTGGGCGTGGTGCGGGATGGCAAGGTGCTGGCGAACCCGCGGCGGACTTACGTCACGCCTCCTGGCACAGGATTCCTTCCAGGTGATACAGCCAGGCATCACCGAGCTGTTATCCTAGACCTGCTGCAGGAGGCACTAACAGAGTCTGGATTAACCTCCCAGGATATCGACTGCATTGCATACACCAAGGGCCCTGGCATGGGTGCCCCACTGGTTTCTGTGGCTGTTGTGGCCCGTACTGTGGCCCAACTGTGGAATAAGCCATTGGTGGGTGTGAACCACTGTATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGCCACCAGCCCAACCGTGTTGTATGTGAGTGGAGGAAATACGCAGGTATTTAGAGGGCTCTACCCACTCCATCTCAATTTCTGAGGCACTGAACCAGTATTTTCTTTGTTCTATCTGAGTCATGGGAATGTCAGGAACAAAGATGGACTTATCTGAACCTAAAATACTGTAGACCAGAAAACCCCCAACAGAGTTTGTAACATTGCAAATTTTGGCAGCATGATCAGAACATTAGATGGCTTATCATTATCAGACTTTATATCTGATTATAAAGATTAGGAATTTCTACTTCAGGAAAGGAATGAATGGGATTGAAAAGGATTGAAATCTTCAAAATAATGAATATCTGAAAGCTCTTGCATTATTTTGAAGCTTATTTTTTCTATAAATCTTAGCAATTGAAACTAACAGTTGCTGGGTATGGCAACTCATGCCTGTAATTCCAGCACT