Transcript asmbl_125119

Sequence
Transcript Sequence for observation asmbl_125119 of TGE0000413:
GCGGCGGCGGCGGCGGCGGCAGCAGCGCGGCCCCTTTAAACGCCTGCGGCGCCCCCCGCCCCCGCCATCGCGCCTCCATTTTCCCGGCCGCCCGCGCCGAGCGCCGCGCCCGCCCCGGGCCCCTCCGCCGCCGCCGGCCCGGACATGGCCGCCAACATGTACAGGGTCGGAGACTACGTCTACTTTGAGAACTCCTCCAGCAACCCATACCTGATCCGGAGAATCGAGGAGCTCAACAAGACGGCCAATGGGAACGTGGAGGCCAAAGTGGTGTGCTTCTACCGGAGGCGGGACATCTCCAGCACCCTCATCGCCCTGGCCGACAAGCACGCAACCCTGTCAGTCTGCTATAAGGCCGGACCGGGGGCGGACAACGGCGAGGAAGGGGAAATAGAAGAGGAAATGGAGAACCCGGAAATGGTGGACCTGCCCGAGAAACTAAAGCACCAGCTGCGGCATCGGGAGCTGTTCCTCTCCCGGCAGCTGGAGTCTCTGCCCGCCACGCACATCAGGGGCAAGTGCAGCGTCACCCTGCTCAACGAGACCGAGTCGCTCAAGTCCTACCTGGAGCGGGAGGATTTCTTCTTCTATTCTCTAGTCTACGACCCACAGCAGAAGACCCTGCTGGCAGATAAAGGAGAGATTCGAGTAGGAAACCGGTACCAGGCAGACATCACCGACTTGTTAAAAGAAGGCGAGGAGGATGGCCGAGACCAGTCCAGGTTGGAGACCCAGGTGTGGGAGGCGCACAACCCACTCACAGACAAGCAGATCGACCAGTTCCTGGTGGTGGCCCGCTCTGTGGGCACCTTCGCACGGGCCCTGGACTGCAGCAGCTCCGTCCGACAGCCCAGCCTGCACATGAGCGCCGCAGCTGCCTCCCGAGACATCACCCTGTTCCACGCCATGGATACTCTCCACAAGAACATCTACGACATCTCCAAGGCCATCTCGGCGCTGGTGCCGCAGGGCGGGCCCGTGCTCTGCAGGGACGAGATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGACCAAACCGCAGTAACATGAGTCCCCACGGCCTCCCAGCCCGGAGCAGCGGGAGCCCCAAGTTTGCCATGAAGACCAGGCAGGCTTTCTATCTGCACACGACGAAGCTGACGCGGATCGCCCGGCGCCTGTGCCGTGAGATCCTGCGCCCGTGGCACGCTGCGCGGCACCCCTACCTGCCCATCAACAGCGCGGCCATCAAGGCCGAGTGCACGGCGCGGCTGCCCGAAGCCTCCCAGAGCCCGCTGGTGCTGAAGCAGGCGGTACGCAAGCCGCTGGAAGCCGTGCTTCGGTATCTTGAGACCCACCCCCGCCCCCCCAAGCCTGACCCCGTGAAAAGCGTGTCCAGCGTGCTCAGCAGCCTGACGCCCGCCAAGGTGGCCCCCGTCATCAACAACGGCTCCCCCACCATCCTGGGCAAGCGCAGCTACGAGCAGCACAACGGGGTGGACGGCAACATGAAGAAGCGCCTCTTGATGCCCAGTAGGGGTCTGGCAAACCACGGACAGGCCAGGCACATGGGACCAAGCCGGAACCTCCTGCTCAACGGGAAGTCCTACCCCACCAAAGTGCGCCTGATCCGGGGGGGCTCCCTGCCCCCAGTCAAGCGGCGGCGGATGAACTGGATCGACGCCCCGGATGACGTGTTCTACATGGCCACAGAGGAGACCAGGAAGATCCGCAAGCTGCTCTCATCCTCGGAAACCAAGCGTGCTGCCCGCCGGCCCTACAAGCCCATCGCCCTGCGCCAGAGCCAGGCCCTGCCGCCGCGGCCACCGCCACCTGCGCCCGTCAACGACGAGCCCATCGTCATCGAGGACTAGGGGCCGCCCCCACCTGCGGCCGCCCCCCGCCCCTCGCCCGCCCACACGGCCCCTTCCCAGCCAGCCCGCCGCCCGCCCCTCAGTTTGGTAGTGCCCCACCTCCCGCCCTCACCTGCAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACTTATTCCGAGAATGCCGAGGAGTTGTCGTTTTTAGCTTTGTGTTTACTTTTTGGCTGGAGCGGAGATGAGGGGCCACCCCGTGCCCCTGTGCTGCGGGGCCTTTTGCCCGGAGGCCGGGCCCTAAGGTTTTGTTGTGTTCTGTTGAAGGTGCCATTTTAAATTTTATTTTTATTACTTTTTTTGTAGATGAACTTGAGCTCTGTAACTTACACCTGGAATGTTAGGATCGTGCGGCCGCGGCCGGCCGAGCTGCCTGGCGGGGTTGGCCCTTGTCTTTTCAAGTAATTTTCATATT