Transcript asmbl_124695

Sequence
Transcript Sequence for observation asmbl_124695 of TGE0000387:
GTGGGGAGGAGCCGGAAGTTAAGGAGGGGAGGGGGTGGAGGGAAAAGCAAGCCAGGAGGTGCTTGCGGCCGCTTCTAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTACGGCTGCTCCGGAGCTGGTGGCGCCGCGATAGGAGAGCCGATGGCCAAGTGGGGTGAGGGAGACCCACGCTGGATCGTGGAGGAGCGGGCGGACGCCACCAACGTCAACAACTGGCACTGGACGGAGAGAGATGCTTCAAATTGGTCCACGGATAAGCTGAAAACACTGTTCCTGGCAGTGCAGGTTCAAAATGAAGAAGGCAAGTGTGAGGTGACGGAAGTGAGTAAGCTTGATGGAGAGGCATCCATTAACAATCGCAAAGGGAAACTTATCTTCTTTTATGAATGGAGCGTCAAACTAAACTGGACAGGTACTTCTAAGTCAGGAGTACAATACAAAGGACATGTGGAGATCCCCAATTTGTCTGATGAAAACAGCGTGGATGAAGTGGAGATTAGTGTGAGCCTTGCCAAAGATGAGCCTGACACAAATCTCGTGGCCTTAATGAAGGAAGAAGGGGTGAAACTTCTAAGAGAAGCAATGGGAATTTACATCAGCACCCTCAAAACAGAGTTCACCCAGGGCATGATCTTACCTACAATGAATGGAGAGTCAGTAGACCCAGTGGGGCAGCCAGCACTGAAAACTGAGGAGCGCAAGGCTAAGCCTGCTCCTTCAAAAACCCAGGCCAGACCTGTTGGAGTCAAAATCCCCACTTGTAAGATCACTCTTAAGGAAACCTTCCTGACGTCACCAGAGGAGCTCTATAGAGTGTTTACCACCCAAGAGCTGGTGCAGGCCTTTACCCATGCTCCTGCAACATTAGAAGCAGACAGAGGTGGAAAGTTCCACATGGTAGATGGCAACGTCTCTGGGGAATTTACTGATCTGGTCCCTGAGAAACATATTGTGATGAAGTGGAGGTTTAAATCTTGGCCAGAGGGACACTTTGCCACCATCACCTTGACCTTCATCGACAAGAACGGAGAGACTGAGCTGTGCATGGAAGGTCGAGGCATCCCTGCTCCTGAGGAAGAGCGGACGCGACAGGGCTGGCAGCGGTACTACTTTGAGGGCATTAAACAGACCTTTGGCTATGGCGCACGCTTATTTTAGGGCCAGCGGCAGGGGACTCCAGCCTGCTGGACACTTCAGTCCAGCTCTCTCCTGACTGGGGCTTGCGACTCACAGGATTGCATCGTCCCAGCTGCTAACTTGGGGCCGGGGCCCCTCCCTTCCACATATACCTTGGGTTTGTGCATGTTTTCTGCTGGGTGGGTTCAGAGGGCAATTTCTCTTTTATGTGTACATATGCTAAATAAACATAATTT