Transcript asmbl_27717

Sequence
Transcript Sequence for observation asmbl_27717 of TGE0001042:
CTTGCTTCCGGCTGACGTGTCTTTCAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTAGACGAGCTGTTCGACGTAAAGAACGCCTTCTACATCGGCAGCTACCAGCAGTGCATAAACGAGGCGCAGCGGGTGAAGCTATCAAGCCCAGAGAGAGACGTGGAGAGGGACGTCTTCCTGTATAGAGCGTACCTGGCGCAGAGGAAGTTCGGTGTGGTCCTGGATGAGATCAAGCCCTCCTCGGCCCCTGAGCTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACGAGAGTCGGAGGGACAGCATCGTGGCCGAGCTGGACCGAGAGATGAGCAGGAGCGTGGACGTGACCAACACCACCTTCCTGCTCATGGCCGCCTCCATCTATCTCCACGACCAGAACCCGGATGCCGCCCTGCGTGCGCTGCACCAGGGGGACAGCCTGGAGTGCACAGCCATGACAGTGCAGATCCTGCTGAAGCTGGACCGCCTGGACCTCGCCCGGAAGGAGCTGAAGAGAATGCAGGACCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGCCTGGGTCAGCCTGGCCACGGGTGGTGAGAAGCTGCAGGATGCCTACTACATCTTCCAGGAGATGGCTGACAAGTGCTCGCCCACCCTGCTGCTGCTCAATGGGCAGGCGGCCTGCCACATGGCCCAGGGCCGCTGGGAGGCCGCTGAGGGCCTGCTGCAGGAGGCGCTAGACAAGGATAGTGGCTACCCAGAGACGCTGGTCAACCTCATCGTCCTGTCCCAGCACCTGGGCAAGCCCCCTGAGGTGACAAACCGATACCTGTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCTTCATCAAGGAGTACCAGGCCAAGGAGAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTGAGGCTGGCCCAGAGCTGTCAGGACCATGAAGCCAGGACAGAGGCCAGGAGCCAGCCCTGCAGCCCTCCCCACCCGGCATCCACCTGCATCCCCTCTGGGGGCAGGAGCCCACCCCCAGCACCCCCATCTGTTAATAAATATCTCAACTCCAGGGTGTTCCACCTGA