Transcript asmbl_124117

Sequence
Transcript Sequence for observation asmbl_124117 of TGE0000380:
TCCTGGGGGCCGGAGCCGCGGAACGAGCCACAGAGAAAAAGGTTATTGGTTGGCAGTTCAGCCAATGAGCGGGCCTGTTACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACCTGTCAGCCTCTACATTCTCTCCTGACGGAAGAGTTTTTCAAGTTGAATATGCTATGAAGGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGCAAAGATGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAAAGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGGTCTTACAGTGTGAATGACGGTGCGCAACTCTACATGATTGACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAGCTTCAGATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGTTGCAAAAATAATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGGTTGGTGAATTAACTAATGGAAGACATGAAATTGTTCCAAAAGATATAAGAGAAGAAGCAGAGAAATATGCTAAGGAATCTCTGAAGGAAGAAGATGAATCAGATGATGATAATATGTAACATTTACTCCAGCATCTATTGTATTTTAAATTTCTACTCCAGTCCAATGTAACTATTTAGCCCTGGATTATACATACTGTCCAATTTTCATTAAATTTTTGTCTTATAACTATTGAAGTTTGGTTAATATCTGCTTTACAAAATTGGTGGGGGTAAATGAGGACATTTACTCAGTATTAAAATATAGATTTATGACTACTGAAAAATTCCCTGGTTAAAATGCTGCAGAATTAATTCCAAGACTGTAGATTAATTCAAAGCCCCATCTTCATCACTCAACTAGAATTTACAGATCATATTCTCCTGGGCTTTTGTACAAAAAGCACCTACCAACTTAGTGGACAAATAACTGATACGGTTTCCCACTTTCATATGAAGTAACTGGTGGTCATCAGTCACTGTTAATCTTTAGATGTGATACAGATGACAGATGTTTCAGTTTTGGATAATTTTTCAAAAACTGACCCTTCTCAAAAAAGACCCTTCAATACATGAGTCAAGGATGTTTTTGCTTTTTTCCTTTATTGTGGTGAGGGGCGGATTTAAGGATCAATAAAGTCCCTATTCTGTCACTAAAAAAATTTCTTGATCTCTAAAGATTAAAATAAAAATACCAACATCAGACAGCTTTCATGTTAAAAATCAGAATTTATGTTAAAGTGCTCTGTAAACAGAACTGTTACTAAGTGGAATAAACAGTACTGTGGCCGATAAGAATAACTTGAAGCTGAAAAGCAGTACTCACAGCAGGAACAATTTGAACTCAGGCCATGTATACACACCCTCTAGTGGACTCATGCCAGTGTCACTCCATTGAAGTGTTGTGCTTTCCTAAGAAGGTAATCTAGCCACTGAATTTGGGTGCAGGGTATCGCTGGACTTTGAGCATTTGTGTAGTTTAAATAGCAAATCATTATACCTGAGTATTAATAGCTAACTACTACACAAACAACTCAAAACCAGTAATGTCATGTCATTACCATGGCTTCTTTTATGTAACATTATCTGCTACATTTTACCACTCAAAATATATTTAAAATATGTATTTTAAAATATATTAGAGCATATGGCTCAAGCAATCCTCCCACCTC