Transcript asmbl_105603

Sequence
Transcript Sequence for observation asmbl_105603 of TGE0000354:
AGCGTACCCGGCGTGGCTCCCGTCTCCGCCCAGTCGTAGGCGCTGGCCGCTGACATGTTGAGGACTACGCGCGGCCCAGGCCTGGGCCCCCCGCTGCTCCAGGCCGCGCTGGGCCTTGGGCGGGCTGGGTGGCACTGGCCTGCGGGCCGGGCGGCGAGCGGGGGGCGCGGGCGGGCCTGGCTGCAGCCCACGGGCCGGGAGACGGGTGTGCAGGTGTACAACAGCCTCACCGGGAGGAAGGAACCCCTAATCGTGGCGCACGCCGAAGCCGCCTCCTGGTATAGCTGTGGACCAACTGTATATGATCATGCGCACCTTGGCCATGCTTGCTCATATGTTAGATTTGATATCATTCGAAGGATCCTAACCAAGGTTTTTGGATGCAGCATAGTCATGGTGATGGGTATTACAGATGTAGATGATAAAATCATCAAAAGAGCCAATGAGATGAATATTTCCCCCGCTTCCCTCGCCAGTCTTTATGAGGAAGACTTCAAGCAGGACATGGCAGCCCTGAAGGTTCTCCCACCCACGGTGTACCTGAGGGTAACCGAAAATATTCCTCAGATAATTTCTTTCATTGAAGGAATCATTGCTCGTGGGAACGCTTATTCAACGGCAAAAGGCAATGTCTACTTCGATCTGAAGTCTAGAGGAGACAAGTATGGCAAATTGGTCGGCGTGGTCCCTGGTCCAGTCGGAGAGCCAGCGGACTCTGACAAGCGTCATGCCAGTGACTTCGCCCTGTGGAAGGCGGCCAAACCCCAGGAGGTGTTCTGGGCCTCTCCCTGGGGACCCGGGAGGCCGGGCTGGCACATCGAGTGCTCTGCCATCGCTAGTATGGTATTTGGAAGTCAACTGGATATCCATTCAGGTGGGATAGATTTAGCTTTTCCACATCATGAAAACGAAATTGCACAGTGCGAAGTCTTTCATCAGTGCGAGCAGTGGGGAAATTATTTTCTGCATTCTGGGCATTTGCACGCCAAAGGCAAAGAAGAAAAAATGTCCAAATCATTAAAGAACTACATTACTATTAAGGACTTTCTGAAGACCTTTTCCCCCGATGTCTTCCGGTTCTTCTGCCTGCGGAGCAGCTACCGCTCAGCCATCGACTACAGTGACAGCGCCATGCTCCAAGCTCAGCAGCTGCTCCTGGGGCTGGGCTCTTTCCTGGAGGACGCACGTGCCTACATGAAGGGGCAGCTGGCCTGCGGCTCCGTCAGGGAAGCGATGCTGTGGGAGAGGCTCTCCAGCACCAAGAGGGCCGTGAAGGCGGCCTTGGCAGATGATTTTGACACACCCAGGGTGGTTGATGCCATCCTGGGCCTTGCACACCACGGGAATGGACAGCTCAGGGCGTCCCTGAAGGAACCTGAAGGGCCGAGAAGTCCTGCTGTGTTTGGTGCCATCATCTCTTACTTTGAACAGTTTTTTGAAACTGTTGGAATTTCTCTGGCAAATCAACAGTACGTTTCAGGAGACGGCAGCGAGGCTACCTTGCATGGTGTGGTGGACGAGCTGGTGCGGTTCCGGCAGAAGGTCCGGCAGTTTGCGCTGGCCATGCCCGAGGCCACGGGGGACGCCCGGCGGCAGCAGCTCCTAGAAAGGCAGCCCCTGCTGGAAGCATGCGACACCCTGCGCCGGGGCCTGACTGCCCACGGCATCAACATCAAGGACAGAAGCAGTACAACATCCACGTGGGAACTGCTGGATCAAAGGACAAAAGACCAAAAATCAGCGGGCTGAGGATGGAGCACAGCCATGAACCTGCTCACGACAAGACGCACCCATGCTTCTCAGGGTCAAGGCTTTATGTTAAAGCTTCCTGTCGGGGCTGCTAGGTCAGCATTAAAGTAAGGCAACCAACAGTGTCCCACTGGCGTCTGTTTGTTAGTAACTGAGCCTAAACACTCACTGCG