Transcript asmbl_105530

Sequence
Transcript Sequence for observation asmbl_105530 of TGE0067270:
CCCGCCGCCCGAGGGCTGCGCGCGGCCCGCGGGCCTCGCCGCCCCGCGCGGATCGTCGCGGCCCGGCCGTCCCGTCCCAGGAAGTGGCCGTCCTGAGCGCCATGGCTCACTCCCCGGTGCAGTCGGGCCTGCCCGGCATGCAGAACCTAAAGGCAGACCCAGAAGAGCTTTTTACAAAACTAGAGAAAATTGGGAAGGGCTCCTTTGGAGAGGTGTTCAAAGGCATTGACAATCGGACTCAGAAAGTGGTTGCCATAAAGATCATTGATCTGGAAGAAGCTGAAGATGAGATAGAGGACATTCAACAAGAAATCACAGTGCTGAGTCAGTGTGACAGTCCATATGTAACCAAATATTATGGATCCTATCTGAAGGATACAAAATTATGGATAATAATGGAATATCTTGGTGGAGGCTCCGCACTAGATCTATTAGAACCTGGCCCATTAGATGAAACCCAGATCGCTACTATATTAAGAGAAATACTGAAAGGACTCGATTATCTCCATTCGGAGAAGAAAATCCACAGAGACATTAAAGCGGCCAACGTCCTGCTGTCTGAGCATGGCGAGGTGAAGCTGGCGGACTTTGGCGTGGCTGGCCAGCTGACAGACACCCAGATCAAAAGGAACACCTTCGTGGGCACCCCATTCTGGATGGCACCCGAGGTCATCAAACAGTCGGCCTATGACTCGAAGGCAGACATCTGGTCCCTGGGCATAACAGCTATTGAACTTGCAAGAGGGGAACCACCTCATTCCGAGCTGCACCCCATGAAAGTTTTATTCCTCATTCCAAAGAACAACCCACCGACGTTGGAAGGAAACTACAGTAAACCCCTCAAGGAGTTTGTGGAGGCCTGTTTGAATAAGGAGCCGAGCTTTAGACCCACTGCTAAGGAGTTATTGAAGCACAAGTTTATACTACGCAATGCAAAGAAAACTTCCTACTTGACCGAGCTCATCGACAGGTACAAGAGATGGAAGGCCGAGCAGAGCCATGACGACTCGAGCTCCGAGGATTCCGACGCGGAAACAGATGGCCAAGCCTCGGGGGGCAGTGATTCTGGGGACTGGATCTTCACAATCCGAGAAAAAGATCCCAAGAATCTCGAGAATGGAGCTCTTCAGCCATCGGACTTGGACAGAAATAAGATGAAAGACATCCCGAAGAGGCCTTTCTCTCAGTGTTTATCTACAATTATTTCTCCTCTGTTTGCAGAGTTGAAGGAGAAGAGCCAGGCGTGCGGAGGGAACTTGGGGTCCATTGAAGAGCTGCGAGGGGCCATCTACCTAGCGGAGGAGGCGTGCCCTGGCATCTCCGACACCATGGTGGCCCAGCTCGTGCAGCGGCTCCAGAGATACTCTCTAAGTGGTGGAGGAACTTCATCCCACTGAAATTCCTTTGGCATTTGGGGTTTTGTTTTTCCTTTTTTCCTTCTTCATCCTCCTCCTTTTTTAAAAGTCAACGAGAGCCTTCGCTGACTCCACCGAAGAGGTGCGCCACTGGGAGCCACCCCAGCGCCAGGCGCCCGTCCAGGGACACACACAGTCTTCACTGTGCTGCAGCCAGATGAAGTCTCTCAGATGGGTGGGGAGGGTCAGCTCCTTCCAGCGATCATTTTATTTTATTTTATTACTTTTGTTTTTAATTTTAACCATAGTGCACATATTCCAGGAAAGTGTCTTTAAAAACAAAAACAAACCCTGAAATGTATATTTGGGATTATGATAAGGCAACTAAAGACATGAAACCTCAGGTATCCTGCTTTAAGTTGATAACTCCCTCTGGGAGCTGGAGAATCGCTCTGGTGGATGGGTGTACAGATTTGTATATAATGTCATTTTTACGGAAACCCTTTCGGCGTGCATAAGGAATCACTGTGTACAAACTGGCCAAGTGCTTCTGTAGATAACGTCAGTGGAGTAAATATTCGACAGGCCATAACTTGAGTCTATTGCCTTGCCTTTATTACATGTACATTTTGAATTCTGTGACCAGTGATTTGGGTTTTATTTTGTATTTGCAGGGTTTGTCATTAATAATTAATGCCCCTCTCTTACAGAACACTCCTATTTGTACCTCAACAAATGCAAATTTTCCCCGTTTGCCCTACGCCCCTTTTGGTACACCTAGAGGTTGATTTCCTTTTTCATCGATGGTACTATTTCTTAGTGTTTTAAATTGGAACATATCTTGCCTCATGAAGCTTTAAATTATAATTTTCAGTTTCTCCCCATGAAGCGCTCTCGTCTGACATTTGTTTGGAATCGTGCCACTGCTGGTCTGCGCCAGATGTACCGTCCTTTCCAATACGATTTTCTGTTGCACCTTGTAGTGGATTCTGCATATCATCTTTCCCACCTAAAAATGTCTGAATGCTTACACAAATAAATTTTATAACACGCTTATTTTGCATACTCCTTGAAATGTGACTCTTCAGAGGACAGGGCACCTGCTGTGTATGTGTGGCCGTGCGTGTGTACTCGTGGCTGTGTGTGTGTGATGAGACACTTTGGAAGACTCCAGGGAGAAGTCCCCAGGCCTGGAGCTGCCGAGTGCCCAGGTCAGCGCCCTGGACTGCTTGCGCACTTGCTCACCGAGATGATGCAGTTGGAGGTTGCTGATCTGTGCGATTGCTGTAGCGGTTGCCGGGGACCTTAAGAGTTATTTTGCTTCTCTGGAAGGGGCCTATGCTTGCTAGGCAGGCAGCCAGTGTGTCTGTTTTTCTTGGTTTGCTGTGGGACCTTGCTTGGCGAGGGGGAAAATCTCTGGGTTTCTGGAGTGGGAGGGTTCGTGCAGCAGCTGTTGACTGGTACATGAAGCATTCTTTTATGTTTGTTGAAGCTGATGATTGACATCTCCCGTGGGTGTGCCAGTTCTTGTGGAGTTAAGACAGGATTTTTGGAAGCAAGGAAGTTAGTGGGTGAGCTTGGGGATGTAGCTCAGCTATCTGCTGGTCTAGTGGCCTCTAAGCTATAGGGAGGGGACAGAGCCCTGAGCTACAGATGCTTGAGTGGGTTATTGTGTCGGTTTGCTAGTGCAGTCTGGTTTTTAAGCTCTAAAATTGAGGTATTTTATTAGAAGTGGATTTGGGTTGAACTCTTAATTTGTATAAGGGATATATTTTGGTTGGGGAAATAGAACTGAGTTGCTAATTCTTATTGTACTCATTACTCCATACAAGAATGTTATGTTGAATAATAAAATTGGAGAAGATTTCATTTTGTGTTTCCAGGGAGTATTCTGTGTGGGGAACTGTTTCCTTACGTGAGGCCGGCGGCATAAGTCAAAGATGAGTTTTGTCCTTGCGAATCACACAGATTGAGTCTGTGTTCCCCAGGGTGTGCCGTTACCTGATTTTTAAGTGAGCCAGGGCGGACAGCAGCTTTTCTGATTTACAGAGTTCTTCAGATTTACAAATGGACAATGACATCACAGTTTTTAGCACTGAAGCCAGTCTCATGCTAGTAACAGTGGGTGAGCCGCTCGAGGGACTGGGTTCTAATGAATACTGGTATGAACGGGGAGTCTCTGCAGTCGCCAGACAAATCATACTCAGCCCCTTCCCCCGTAGAGCAACAAGTGGTTCTTTTAGAGTTGACTGGCAGCATTTCCTGTCGGGGGAGGTGGGGTTTGATGGAGTTAGAAAGCTCGCCTCTGTGTACATTCTCTCCTGGGCTGTTACTTTCTGTAGACGCACAAAATCAGCCCCAATGTTTTTAAGGGCATCTTAGCCAAGGAAGCTGGCTTTTGTGTCGCCACTTCCAGGCCTGCATTAAGAGAGAGCCCAGGCACCAGGGCTACCACTGGAACCTGCCTCAGCGTCAACTGCTGCTGGTCTGTAGCCAGGCCCAGCCTTTGAGACGGGTTTACTGTCACCAGTAGCCTCTCAGTGCCAGCCCTGAGCTGCTCCTGGCTCAGCTGCCCAGAGCCTGCAGCCTGGGGAGGTACTCAGCCTCTGGGAGACGAGGGCCGTGGACTGGGTGGCTGGTAGCTCCTGCGTTTTTGAGCTGTGTCCTGGCTGGCTGCTGCCAATGAGGTGGACACCAGTGTGGTTTGGGGTGCACTGGCCACTTCTTGCTGGGTTCTGATTTTCTTGGAAGTGCATCTGCCTTCCTTATCCAATAGTTTTATCCCTGCATTGCTCTTGTGAAGTGGCTGGTTTGGTTCTGTATGTAGCATTTTGTACCTTTCCTCTGGCAAAACACTGTCAGTTTATAAACATTTTTTATATTTCCCTCCTTTAAAAACAGCTTGTGTATTTCTGCTATAAAATGTGTCAGCAAAGGCAGAGTGACCTAATAGGGCATGTTCTTAAGCACAGGGACTGTATCATGCAGGGGCCAATAAAGCTCAAGAAAACGAGTATCTGCATCATTGTGTGTCTCATGTGTAGTGTGTCTCAAACTCCACTCAGATGGACTGTTACCCACACTAGTATTTTCTTGAGGGCACACAGGAAGCAGAGGTGCTGGTCACAGGTCAGAACCACCAGTGTCCAGCAAGTAGTTTGGAATCAATCAAT