Transcript asmbl_44538

Sequence
Transcript Sequence for observation asmbl_44538 of TGE0005638:
CCGAACCGGAAAAGGTGGGTTTCCGGACGCTGCACCTGCCTGGGTGTAGGTGTAGGTGAGCCGCAGTCTCCGCGAGACCTTCCAGAATTATAAAGCTGTCCTCAGAGATCCGAAAAATGGCAACAAATGAAAATGTCAGCATCTTTAGTTCAGCGTCCTTGGCTGTGGAGTATGTAGATTCACTGTTACCTGAGAATCCTCTGCAAGAGCCATTTAAAAATGCTTGGAACTATATGTTAGATAATTATACAAAGTTCCAGATTGCAACATGGGGATCCCTGATAATTCACGAGGTCATTTATTTCTTGTTCAGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAGGCCAATGGAAATGCTTTAAAGTACTTCTCTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACAGAGTATTTCAATATTCCTTATGATTGGGAAACAATGCCAAGATGGTATTTGCTTCTGGCAAGATGCTTTGGTTGTGCAGTGATTGAAGATACCTGGCACTATTTCTTACATAGGCTCTTGCACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCCCTTGAAACGCTAATTCTTGGAACTGGATTTTTCATTGGAATTGTTCTTTTATGTGATCATGTAGTTCTTCTTTGGGCATGGGTGACCATTCGTTTGCTAGAAACTATCGATGTCCACAGTGGTTATGATATTCCTCTCAACCCTCTAAATCTCATCCCATTCTATGCTGGTTCTCGACATCACGATTTTCACCACATGAACTTCATTGGAAACTATGCTTCAACATTCACGTGGTGGGATAGAATTTTTGGAACAGACTCTCAATTTATTGCCTACACTGAAAAGATGAAGAAGATTAAGAAAAAGGCTGAATAAATATCTATGTAAACCTTCCTGAAGAAACACATTTTCCTGGATTAAAAGTAGTAGCTAACATTGCTTCTGGGGAGCAGAAACAAACATGTCTTGGCTGCTAAGTGATGGAAAAAAATTAACAACCTTTATCTTCCTAGTGGGAACTTTTTCTATTTTCCATTCAAGTTCTGTATGTGTAGAAATAAGAAAGGAAGTTTTAAAGGCCGTGTTGCTAACTTTACAAAAAGATTTGTGTAAAGTAAATGGAAAAAGGATTAACCTGTCTGTCCCTACCATTAATACTATAGACCTGAAGTTGAAGTTGGTCTTTAAATCTTAGTGGCCATTTTAACAACTTTTATTAGTGAATGTTGACCTCATCTTGAACTTTAAACGTTTTTTAGAATTTGCCTAAAGATCAAAATATGGGATGAATGACATCAGTTGATACGATGTGAGTGGGGCTGCAAAATCAGGAATAGCCAACACCAAGAATTTCTACTCTTGTCTGGAGCTGACCGATTTGGGGTGATTTTCTTTGAGAAGTCCTTTTGGGTCCCTACTATTGACATCTATAAATTAAAGCAAATCTGAATCGATGTAAGTGGAATATTTTAGTCTAAAGGTTTTCAGGTTTCTTGAATTTTAAATAAATAAATAAATAAACCTTTATTTCTGCCACTTACTGTTTAATATTTGAAAATCAGGTTTTTATTATACTTAAAACTGTATCTTAAAATTTTGTGAACCTACTTGGTGTATTTGCACTTTGAGCTACTGAAATAAATGTGATTTTTTTGCGTCTGGTTATCTGGTCTCCAATTTTGAACATCAGCTGTCACTTTTTATAAGGAAAAGTACATAAATCATTAAATTATTGTTTTATA