Transcript asmbl_105236

Sequence
Transcript Sequence for observation asmbl_105236 of TGE0000342:
CGGGGCCATGGAGACTGAACTGGAGAAGAGCGGGTTCTCGGAGTTAAAAGCGAGAGTGAGTGGGACCGGAGGGGCGGGGCATCATATGGGCGGGGCTGAGGCGAGGCCCCGGCGGCCATCTTGAGCCCCGCCTTTTACTTCGGCCCGCTTCTTCTGGTCACTCCGCCACCGTAGAATCGCCTACCATTTGGTGCAAGCAAAAAGCAATCAGCAATTGGACAGGAAAAGAATGGCATTGAAGCAGATTTCCAGCAACAAGTGCTTTGGGGGATTGCAGAAAGTTTTTGAACATGACAGTGTTGAACTAAACTGCAAAATGAAATTTGCTGTCTACTTACCACCAAAGGCAGAAACAGGAAAGTGCCCTGCACTGTATTGGCTCTCAGGTTTAACTTGCACAGAGCAAAATTTTATATCAAAATCTGGTTATCATCAGTCTGCTTCAGAACATGGTCTTGTTGTCATTGCTCCAGATACCAGCCCTCGTGGCTGCAATATTAAAGGTGAAGATGAGAGCTGGGACTTTGGCACTGGTGCTGGATTTTATGTTGATGCCACTGAAGATCCTTGGAAAACCAACTACAGAATGTACTCTTATGTCACAGAGGAGCTTCCCCAACTCATAAATGCCAATTTTCCAGTGGATCCCCAAAGGATGTCTATTTTTGGCCACTCCATGGGAGGTCATGGAGCTCTGATCTGTGCTTTGAAAAATCCTGGAAAATACAAATCTGTGTCAGCATTTGCTCCAATTTGCAACCCTGTACTCTGTCCCTGGGGCAAAAAAGCCTTTAGTGGATATTTGGGAACAGATCAAAGTAAATGGAAGGCTTATGATGCTACCCACCTTGTGAAATCCTATCCAGGATCTCAGCTGGACATACTAATTGATCAAGGGAAAGATGACCAGTTTCTTTTAGATGGACAGTTACTCCCTGATAACTTCATAGCTGCCTGTACAGAAAAGAAAATCCCCGTTGTTTTTCGATTGCAAGAGGGTTATGATCATAGCTACTACTTCATTGCAACCTTTATTACTGACCACATCAGACATCATGCTAAATACCTGAATGCATGAAAAAACTCCAAATAAGAGAATCTCTTCAGGATTATAAAAGTTGTAAAATGCAACTGTATTGCTGAGC