Transcript asmbl_102983

Sequence
Transcript Sequence for observation asmbl_102983 of TGE0000296:
TTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGATCTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAACCTGCCCTGGGTTGAAAAATACCGGCCACAGACCCTGAATGATCTCATTTCTCATCAGGACATTCTGAGTACCATTCAGAAGTTTATCAATGAAGACCGACTGCCACACTTGCTTCTCTACGGTCCCCCAGGGACAGGCAAGACATCTACCATCCTAGCCTGTGCGAAACAGCTATATAAAGACAAAGAATTTGGCTCCATGGTCTTGGAGCTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAAGAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAGTAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACGAGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAAAGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAGAGCACCAATATGGCCTTTGGGAAGGTGACAGAGGAGACTGTCTACACCTGCACCGGGCACCCGCTCAAGTCAGACATTGCCAACATCCTGGACTGGATGTTGAATCAAGATTTCACCACAGCCTACAGAAATATTACAGAGTTGAAAACTCTGAAGGGGTTGGCACTGCATGATATCCTGACAGAGATACACTTGTTTGTGCATAGAGTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGAGTACAGGCTTTCTGTTGGCACCAACGAGAAGATCCAGCTGAGCTCCCTCATTGCTGCATTTCAAGTCACCAGAGACCTGATTGTTGCAGAGGCCTAGATGCTCTGAGGGCCATTCACAATTCTCAGGGCTCAGCAGTGATGGGAGAACAGAGGACAGTTCCAGGATAAACTGCTGCCTGGGGCTGTGGGATGAATCAGTCACCCCGAATCTTGGAAAAACCCCCTTCCAGGAGAGGATGGGCAGGCATTTAAAAAGTACCATTTTTGTGGTTGTTTGGAGCAGGGATGTACAAAATAATTTTAATGTATTAACTCATACTGCCTGTCTTTTATAGGGGAAAAAAATAACCTTTTTTATTTTAAAGTTATAAGGTTTTTACCTTTTAGTTGCTTGGATGACAGGGAATTAGCCTACCCCATTTTGGTCTGGAACAGAAGACTTTCAAATTTAATATGGTCCAAGTGTCTTCCTACTCAAGGTAAACATTATCTCCAAAATTACATTTATGATTCTAATATTTGGCATTGTGTCTGTATCTAATTTAAACAGATGTTAATGGACGTCTGGCCGAAACTATTATACTTTTATAAGATGAGCTGAATCCTCTTACTTTAAAAACTGGTCTTTTTATTTACCCTCTGTGGTAGAAGAGTCACCAGCAGGTTCCAAATTGATGTGTATGATAGGAAAAAAACCTTAATTTTAAATATAATATAGAGCCTTAAACTATGCCACTGGGTGGCAGAGGCTGTATAAAACGCACTTGTTTTCATGCAGGAGCGGGGCAAGTAAGGTTGAGCCTGACTGTAAACCTAGAACTGCGGAAGGACTGGGACTTTTGTACAAATTTCACATTTATTTTACAGCAATCATGCTGCATTTGTGTTAGTGTTCTTTATAATAAAAAACAAAGCAGCCTCCTGGCTGGCTGTGTTACAAGTGACTCTTCCTTAGACAGCTAGAAAGATGCTGACTTTGTCAAACTTGCATTTATATGAAAACCTTCTGTCTCTAATATCACAGAATAAACTTTCTTTAGATGCTGTTCTTTATAAAATGTCAAATTCTTAAACTGTCAAATGGAAAAAGTCACTATTCCCTTTGTTCATGGAGGACTCACCCCCTTAAGGACAGCGGCAAAGTATGAAGCTAAATATCTGATGGCCAACCAGGCCTCAAACCACCCAGAGGCTCAGCATCTGCTGTACCTGGAACTTCAAGATAACCATGAAATGTAAACGTTGGCCAATCCATTCCCAGCTCTTCTGCTGTACTACTTGTTTTATGTGTTTATTTTTTGAGGCAAGATCATGCTCTGTCAGTCACCCAGGCTGGAATACCGTGACACGATCGTGGCTCGCTACAGCCTCCATGTCCCAGGCTCGAGCAG