Transcript asmbl_102903

Sequence
Transcript Sequence for observation asmbl_102903 of TGE0000294:
CACCCTCTCACCCTAGACAGATGGGAGCCTCCTGGGGTGTCCACGTGAGCGCGCGTGAGTCCGCCCCCCCAGTCACGTGACCGCTGACTCGGGGCGTTCTCCACTATCGCTTACCTACCTCCCTCTGCAGGAACCCGGCGATATGGCTGCCGCTGTGCCCCGCGCCGCATTTCTCTCCCCGCTGCTTCCCCTTCTCCTGGGCTTCCTGCTCCTCTCCGCTCCGCATGGCGGCAGCGGCCTGCACACCAAGGGCGCCCTTCCCCTGGATACGGTCACTTTCTACAAGGTCATTCCCAAAAGCAAGTTCGTCTTGGTGAAGTTCGACACCCAGTACCCCTACGGTGAGAAGCAGGATGAGTTCAAGCGTCTTGCTGAAAACTCGGCTTCCAGCGATGATCTCTTGGTGGCAGAGGTGGGGATCTCAGATTATGGTGACAAGCTGAACATGGAGCTGAGTGAGAAATACAAGCTGGACAAAGAGAGCTACCCAGTCTTCTACCTCTTCCGGGATGGGGACTTTGAGAACCCAGTCCCATACACTGGGGCAGTTAAGGTTGGAGCCATCCAGCGCTGGCTGAAGGGGCAAGGGGTCTACCTAGGTATGCCTGGTTGCCTGCCTGTATACGACGCCCTGGCCGGGGAGTTCATCAGGGCCTCTGGTGTGGAGGCCCGCCAGGCCCTCTTGAAGCAGGGGCAAGATAACCTCTCAAGTGTGAAGGAGACTCAGAAGAAGTGGGCCGAGCAATACCTGAAGATCATGGGGAAGATCTTAGACCAAGGGGAGGACTTCCCAGCATCAGAGATGACACGGATCGCCAGGCTGATTGAGAAGAACAAGATGAGTGACGGGAAGAAGGAGGAGCTCCAGAAGAGCTTAAACATCCTGACTGCCTTCCAGAAGAAGGGGGCCGAGAAAGAGGAGCTGTAAAAAGGCTGTCTGTGATTTTCCAGGGTTTGGTGGGGGTAGGGAGGGGAGAGTTAACCTGCTGGCTGTGAGTCCCTTGTGGAATATAAGGGGGTAGTGGGAAAAGTGGTACTAACCCACGATTCTGAGCCCTGAGTATGCCTGGACATTGATGCTAACATGACCATGCTTGGGATGTCTCTAGCTGGTCTGGGGATAGCTGGAGCACTTACTCAGGTGGCTGGTGAAATGACACCTCAGAAGGAATGAGTGCTATAGAGAGGAGAGAGGAGTGTACTGCCCAGGTCTTTGACAGATGTAATTCTCATTCAATTAAAGTTTCAGTGTTTTGGTTAAGTGGACCTGAAGCCATTCTTTTTTCTTTTCAAATTATACTTTCGTCTATGACCTGCTTTCCTCTTTGAATCTAAGCTGGTATAGACTCCACTTTCCCAGGGTAACAAACTATCCTCATAACACTGTGGAAACTGGCATACCTTTGTTATTTTCCAGTGATATTCAGACTGACATGGATTGACTGTCAATGGTAAAGTTTGTCTATTTTCCAGTCCTTAAAACTCAATAGCAGTATTGATGAATATATTGAACCAACATTGATGGACCATGGTGTAATTATTTTCCATGCTTTGTGAGGTACACATAGCAAATTCTTAGTTTTACTGATATATTCTGTGACTTGGATTTACACAGCTAAATGATATAGTCCGATTTCAAAATTAAAAAATATTTTCCATCTAAATCACTATCACTAAATAAATACTAACTTCTAGAAAGCAGAATAAAGAGCACTTGTGCCAACATTCACATCTTTTCTTCAGACTCAGAAGCAGTTATCTGCAAAAGTGAGCTTCACGACAGCTCTACTTTCATATTTAACCATTTGAAAATGTCATGAGACCACAGCTCCTGAAATATATCTAATTGCACCCACACAAAGAATGGAGTTGGCAAATAAGACCTTGAATTATTTTCCTCCATTTTATCCAGGTTGGTATATATTTAGTTCCTGGAAACAAAAAATAGAGGAAATTCCATATGTTGAATTGGATGGGACAAAAAATTGTGGTAGCTTAGGCTAACAGTTCAAACCAAGGAGGTAAAAAGTGTTTAAACCTAAACACCCACCTGCTGACAGCTTATGTACTCTACATATAATGAAAGAATATAATAATATTTACTATAATAATTTCTACATTTTTACTTCAGTTCTCACTGAAACTTCTGGAAGATCTTTTTGGATACTTCTAACTGGTAAATTTGCTTTGGCTGTTCTAGTGTGCTCCGTGTAAACGGGATCACTTCCAAAGAGCAAAGTATTCACTGTTTTATGGAAATTAGAATGAGACAACAAATGGCAGGTAGGGAAAGGACTCTAATATTAAATGCATCCAGAGTCCCTGAATGAAGACTAATCTTGATTTTCAATTGTAAGAAGCAGGAAGGTGACAGTACCTCCATGGGCACGGCACTGGATGGGTTCTGGCTGGATATGGTTATTTACAACCCCAGGGCCTTGAGTTGAAGAAACCTGAGCTATTGGGCGGAACTACATTATCATATGTCAGAGGCCCTTTGTTACCCAATAGTTGTTTTCATTAAAGGTGAGCCCTCTTTCTAGAGTCTTAAGTGATTTGCATATGTCACATAAAATACAGTCTTCCCTGACCCAAGTCAAATGGATTCCTTTACCTCTTAGAATTTACTAATATTGTGGCTCAAGTGCTGCTATTCAGATTCTAATGAAGACTATGGACTGGATTCCCAGAATCAATCAAATACTTATAGTTATTTTTTTAAGAGATGGGCATCTTGCTTTGTTGCGCAGGCTAGACTTGAATTCCTGGGCTAAAGCGATCCTCCCGCCTCAGCCT