Transcript asmbl_102728

Sequence
Transcript Sequence for observation asmbl_102728 of TGE0000287:
GACTCTGGCAGTTAGCCCGCCCGCTCGGCGCAGGGCGTGGCTTCTCGTAGCCATTAGGAAACAGCAACCCTTTCACCTCAGTTTTCTTCACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCTTCATCATTCTCAAATTCTTGCTTATCAGGAGGGCAGACTTCAAAAGCTACTAAAAATGAACGGCCCTGAAGATCTTCCCAAGTCCTATGACTATGACCTTATCATCATTGGAGGTGGCTCAGGAGGTCTGGCAGCTGCTAAGGAGGCAGCCCAATATGGCAAGAAGGTGATGGTCCTGGACTTTGTCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAATGTGGGTTGCATACCTAAAAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATCAAGTTTATAAGACAGTTCGTACCAATTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGAGTAGTAGCTCAGTCCACCAATAGTGAGGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATAGGAAGAGATGCTTGCACAAGAAAAATTGGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGAAAAATACCTGTCACAGATGAAGAACAGACCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAGGATAAGGTGGAGCTCACCCCAGTTGCAATCCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGTTCCACTGTCAAGTGTGACTATGAAAATGTTCCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGTGGCCTTTCTGAGGAGAAAGCTGTGGAGAAGTTTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTTTGGCCATTGGAATGGACGATTCCGTCAAGAGATAACAACAAATGTTATGCAAAAATAATCTGTAATACTAAAGACAATGAACGTGTTGTGGGCTTTCACGTACTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTTGCAGCTGCGCTCAAATGTGGACTGACCAAAAAGCAGCTGGACAGCACAATTGGAATCCACCCTGTCTGTGCAGAGGTATTCACAACATTGTCTGTGACCAAGCGCTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGAGGTTAAGCCCCAGTGTGGATGCTGTTGCCAAGACTGCAAACCACTGGCTCGTTTCCGTGCCCAAATCCAAGGCGAAGTTTTCTAGAGGGTTCTTGGGCTCTTGGCACCTGCGTGTCCTGTGCTTACCACCGCCCAAGGCCCCCTTGGATCTCTTGGATAGGAGTTGGTGAATAGAAGGCAGGCAGCATCACACTGGGGTCACTGACAGACTTGAAGCTGACATTTGGCAGGGCATCGAAGGGATGCATCCATGAAGTCACCAGTCTCAAGCCCATGTGGTAGGCGGTGATGGAACAACTGTCAAATCAGTTTTAGCATGACCTTTCCTTGTGGATTTTCTTATTCTCGTTGTCAAGTTTTCTAGGGTTGAATTTTTTTCTTTTTTCTCCATGGTGTTAATGATATTAGAGATGAAAAACGTTAGCAGTTGATTTTTGTCCAAAAGCAAGTCATGGCTAGAGTATCCATGCAAGGTGTCTTGTTGCATGGAAGGGATAGTTTGGCTCCCTTGGAGGCTATGTAGGCTTGTCCCGGGAAAGAGAACTGTCCTGCAGCTGAAATGGACTGTTCTTTACTGACCTGCTCAGCAGTTTCTTCTCTCATATATTCCCAAAACAAGTACATCTGCGATCAACTCTAGCCAAATTTGCCCCTGTGTGCTACATGATGGATGATTATTATTTTAAGGTCTGTTTAGGAAGGGAAATGGCTACTTGGCCAGCCATTGCCTGGCATTTGGTAGTATAGTATGATTCTCACCATTATTTGTCATGGAGGCAGACATACACCAGAAATGGGGGAGAAACAGTACATATCTTTCTGTCTTTAGTTTATTGTGTGCTGGTCTAAGCAAGCTGAGATCATTTGCAATGGAAAACACGTAACTTGTTTAAAAGTTTTTCTGGTAGCTTTAGCTTTATGCTAAAAAAAATAATGACATTGGGTATCTATTTCTTTCTAAGACTACATTAGTAGGAAAATAAGTCTTTTCATGCTTATGATTTAGCTGTTTTGTGGTAATTGCTTTTTAAAGGAAGTTATTAATATCATAAGTTATTATTAATATTTTGAACACAGGTGGATGTGAAGGATTTTCATTTAAAAACCAAGTGGTTTTGACTTTTTCTGTTGAATGAACAACTGTGCCTTGTGGAATTTTTGCAGAAGTGTTTATGCTTTGTTAGCATTTCAACTTGCATTATTATAAAGAGGTATTAATGCCTCAGTTATGTGTTTGTCAATGTACTGGCTGAGGATTCTATCTCAGCTGTCTTTTCTAACTGTGTAGGTTGAGTTTTGAACACGTGCTTGTGGACATCAGGCCTCCTGCCAGCAGTTCTTGAAGCTTCTTTTTCATTCCTGCTACTCTACCTGTATTTCTCAGTTGCAGCACTGAGTGGTCAAAATACATTTCTGGGCCACCTCAGGGAACCCATGCATCTGCCTGGCATTTAGGCAGCAGAGCCCCTGACCGTCCCCCACAGGGCTCTGCCTCACGTCCTCATCTCATTTGGCTGTGTAAAGAAATGGGAAAAGGGAAAAGGAGAGAGCAATTGAGGCAGTTGACCATATTCAGTTTTATTTATTTATTTTTAATTTGTTTTTTTCTCCAAGTCCACCAGTCTCTGAAATTAGAACAGTAGGCGGTATGAGATAATCAGGCCTAATCATGTTGTGATTCTCTTTTCTTAGTGGAGTGGAATGTTCTATCCCCACAAGAAGGATTATATCTTATAGACTTGTCTTGTTCAGATTCTGTATTTACCCATTTTATTGAAACATATACTAAGTTCCATGTATTTTTGTTACAAATCTTCTGAAAAAAAACAAAACAATGTGAAACATTAAAATTAAAAGGCATTAATAATATCCACGTGTGCCTTCTTACTGAATGATGGTCTTGGGAGTCTTTGCAAGAGTATTGAGTAGATCTCTGATATTGTGTTGAAAAGCTAGCTGCTGAGTAGGCTCCAATGATGCTATGCTGATTTAAGTATAGAAGAACTAATCAGTTCATTGCCATTTCCCATCTTCTGGCAGTATCAGGCACATAGATGGTCAATAAATGTTTCCAGAAATGTTGATTACCATGTTCAGATTATGCATTCACATGCACTTAATCTTCTTAGGTATCACTTTTTAAGCAGAAACTCCTCTTTTATGTAATCTTTACCAAAAACCTTCCCAG